Incidental Mutation 'R7244:Olfr556'
ID563413
Institutional Source Beutler Lab
Gene Symbol Olfr556
Ensembl Gene ENSMUSG00000073969
Gene Nameolfactory receptor 556
SynonymsMOR41-1, GA_x6K02T2PBJ9-5386601-5387575
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7244 (G1)
Quality Score176.009
Status Validated
Chromosome7
Chromosomal Location102664899-102673270 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 102669839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098219] [ENSMUST00000213485] [ENSMUST00000217526]
Predicted Effect probably benign
Transcript: ENSMUST00000098219
SMART Domains Protein: ENSMUSP00000095822
Gene: ENSMUSG00000073969

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1.2e-85 PFAM
Pfam:7TM_GPCR_Srsx 39 192 1.5e-13 PFAM
Pfam:7tm_1 45 297 3.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213485
Predicted Effect probably benign
Transcript: ENSMUST00000217526
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Cyp2c54 A G 19: 40,047,509 V319A probably damaging Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Edrf1 T C 7: 133,654,350 S643P probably benign Het
Fam186a A T 15: 99,946,392 V657D unknown Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nadk2 A G 15: 9,083,191 probably null Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdha11 A T 18: 37,011,368 R171* probably null Het
Pkd1l1 A T 11: 8,871,771 V1641E Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vmn2r109 A G 17: 20,540,683 V804A possibly damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Olfr556
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr556 APN 7 102670651 missense probably damaging 1.00
IGL01662:Olfr556 APN 7 102670720 missense probably damaging 1.00
IGL02989:Olfr556 APN 7 102670444 missense possibly damaging 0.50
R0194:Olfr556 UTSW 7 102670199 missense probably benign 0.01
R1670:Olfr556 UTSW 7 102670402 missense possibly damaging 0.72
R1680:Olfr556 UTSW 7 102670733 missense possibly damaging 0.82
R1711:Olfr556 UTSW 7 102670162 missense probably damaging 0.98
R1768:Olfr556 UTSW 7 102670301 missense probably damaging 1.00
R1950:Olfr556 UTSW 7 102670477 missense probably benign 0.03
R4452:Olfr556 UTSW 7 102670049 missense probably benign 0.00
R5564:Olfr556 UTSW 7 102670226 missense probably damaging 1.00
R6623:Olfr556 UTSW 7 102670034 missense possibly damaging 0.90
R7040:Olfr556 UTSW 7 102670730 missense probably benign 0.00
R7300:Olfr556 UTSW 7 102670210 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTCAACACCTGCATGGG -3'
(R):5'- GTACTCAGTGAGATGGCCAG -3'

Sequencing Primer
(F):5'- CTCAACACCTGCATGGGGAGAG -3'
(R):5'- GCCAGCCAAAGATAAGAAGACTG -3'
Posted On2019-06-26