Incidental Mutation 'R7244:Edrf1'
ID563415
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Nameerythroid differentiation regulatory factor 1
Synonyms2700050L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R7244 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location133637543-133672971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133654350 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 643 (S643P)
Ref Sequence ENSEMBL: ENSMUSP00000059166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901] [ENSMUST00000138370]
Predicted Effect probably benign
Transcript: ENSMUST00000051169
AA Change: S643P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990
AA Change: S643P

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128901
AA Change: S609P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990
AA Change: S609P

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138370
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Cyp2c54 A G 19: 40,047,509 V319A probably damaging Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Fam186a A T 15: 99,946,392 V657D unknown Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nadk2 A G 15: 9,083,191 probably null Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr556 G T 7: 102,669,839 probably benign Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdha11 A T 18: 37,011,368 R171* probably null Het
Pkd1l1 A T 11: 8,871,771 V1641E Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vmn2r109 A G 17: 20,540,683 V804A possibly damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133653949 nonsense probably null
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R2920:Edrf1 UTSW 7 133667572 missense probably benign 0.00
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133651910 intron probably null
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133647359 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AAATGCTGCTGTGTGCTTAAG -3'
(R):5'- AAAGGATCCCTGACTCTTCATC -3'

Sequencing Primer
(F):5'- AAATGCTGCTGTGTGCTTAAGTTTTG -3'
(R):5'- GGATCCCTGACTCTTCATCTCCATG -3'
Posted On2019-06-26