Incidental Mutation 'R7244:Pkd1l1'
ID563423
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7244 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8871771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1641 (V1641E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: V1641E

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178195
AA Change: V1191E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: V1191E

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Cyp2c54 A G 19: 40,047,509 V319A probably damaging Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Edrf1 T C 7: 133,654,350 S643P probably benign Het
Fam186a A T 15: 99,946,392 V657D unknown Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nadk2 A G 15: 9,083,191 probably null Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr556 G T 7: 102,669,839 probably benign Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdha11 A T 18: 37,011,368 R171* probably null Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vmn2r109 A G 17: 20,540,683 V804A possibly damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
R8052:Pkd1l1 UTSW 11 8947315 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- GCTAGGAGCTCTGAGTTATGC -3'
(R):5'- TGAAGTGTCCAGCTTCCAGC -3'

Sequencing Primer
(F):5'- GAGCTCTGAGTTATGCTTGTTAAAAG -3'
(R):5'- GCCAAGAAATGATAAGAGACTCATTC -3'
Posted On2019-06-26