Incidental Mutation 'R7244:Fam186a'
ID563431
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7244 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99946392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 657 (V657D)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: V657D
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: V657D

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Cyp2c54 A G 19: 40,047,509 V319A probably damaging Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Edrf1 T C 7: 133,654,350 S643P probably benign Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nadk2 A G 15: 9,083,191 probably null Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr556 G T 7: 102,669,839 probably benign Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdha11 A T 18: 37,011,368 R171* probably null Het
Pkd1l1 A T 11: 8,871,771 V1641E Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vmn2r109 A G 17: 20,540,683 V804A possibly damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7658:Fam186a UTSW 15 99939844 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99943308 missense probably damaging 0.99
R7970:Fam186a UTSW 15 99933586 missense unknown
R8076:Fam186a UTSW 15 99943470 missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99941844 missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99944033 frame shift probably null
R8239:Fam186a UTSW 15 99941310 missense unknown
R8246:Fam186a UTSW 15 99940547 missense unknown
R8446:Fam186a UTSW 15 99947454 missense unknown
R8469:Fam186a UTSW 15 99947305 missense unknown
R8676:Fam186a UTSW 15 99947142 missense unknown
R8790:Fam186a UTSW 15 99943143 missense possibly damaging 0.90
R8808:Fam186a UTSW 15 99944723 missense possibly damaging 0.83
R8848:Fam186a UTSW 15 99940153 missense possibly damaging 0.83
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAATGCTTGCATCCACACC -3'
(R):5'- GTCGTCACTGGGAAAAGCAG -3'

Sequencing Primer
(F):5'- GCTTGCATCCACACCTCCAG -3'
(R):5'- CGTCACTGGGAAAAGCAGAAGTTG -3'
Posted On2019-06-26