Incidental Mutation 'R7244:Vmn2r109'
ID563434
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Namevomeronasal 2, receptor 109
SynonymsEG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7244 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20540517-20564756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20540683 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 804 (V804A)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167093
AA Change: V804A

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: V804A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Cyp2c54 A G 19: 40,047,509 V319A probably damaging Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Edrf1 T C 7: 133,654,350 S643P probably benign Het
Fam186a A T 15: 99,946,392 V657D unknown Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nadk2 A G 15: 9,083,191 probably null Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr556 G T 7: 102,669,839 probably benign Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdha11 A T 18: 37,011,368 R171* probably null Het
Pkd1l1 A T 11: 8,871,771 V1641E Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATTCAGGTTTGATGCCACC -3'
(R):5'- TTCCACTGTGTTCTGGGATAC -3'

Sequencing Primer
(F):5'- GGTTTGATGCCACCAATTCATAGAC -3'
(R):5'- GGATACCTCTGCTCCTTGGC -3'
Posted On2019-06-26