Incidental Mutation 'R7244:Pcdha11'
ID563436
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Nameprotocadherin alpha 11
SynonymsA830022B16Rik, Crnr7, Cnr7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7244 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37010712-37187657 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 37011368 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 171 (R171*)
Ref Sequence ENSEMBL: ENSMUSP00000111321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115657
AA Change: R171*
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206
AA Change: R171*

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192447
AA Change: R171*
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206
AA Change: R171*

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Cyp2c54 A G 19: 40,047,509 V319A probably damaging Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Edrf1 T C 7: 133,654,350 S643P probably benign Het
Fam186a A T 15: 99,946,392 V657D unknown Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nadk2 A G 15: 9,083,191 probably null Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr556 G T 7: 102,669,839 probably benign Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pkd1l1 A T 11: 8,871,771 V1641E Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vmn2r109 A G 17: 20,540,683 V804A possibly damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37007373 missense probably benign 0.13
R4489:Pcdha11 UTSW 18 37006916 missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37012169 unclassified probably null
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7319:Pcdha11 UTSW 18 37013192 missense probably benign 0.10
R7352:Pcdha11 UTSW 18 37006845 missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
R7660:Pcdha11 UTSW 18 37005851 missense probably benign 0.17
R7677:Pcdha11 UTSW 18 37011552 missense probably damaging 1.00
R7707:Pcdha11 UTSW 18 37011792 missense probably benign 0.00
R7775:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7778:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7780:Pcdha11 UTSW 18 37012796 missense probably damaging 0.97
RF017:Pcdha11 UTSW 18 37005524 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTTTGTGAATTCTCGGATCGACC -3'
(R):5'- TGAACTGTACCCGTGAGCTC -3'

Sequencing Primer
(F):5'- AGTGCAGCATCCACCTGG -3'
(R):5'- ACCCGTGAGCTCCGGTTTTC -3'
Posted On2019-06-26