Incidental Mutation 'R7244:Cyp2c54'
ID563438
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7244 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40037941-40073811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40047509 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
Predicted Effect probably damaging
Transcript: ENSMUST00000048959
AA Change: V319A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: V319A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Edrf1 T C 7: 133,654,350 S643P probably benign Het
Fam186a A T 15: 99,946,392 V657D unknown Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nadk2 A G 15: 9,083,191 probably null Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr556 G T 7: 102,669,839 probably benign Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdha11 A T 18: 37,011,368 R171* probably null Het
Pkd1l1 A T 11: 8,871,771 V1641E Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vmn2r109 A G 17: 20,540,683 V804A possibly damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40072078 missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40047543 missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40072365 critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40070228 missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40047658 splice site probably benign
R0097:Cyp2c54 UTSW 19 40047659 splice site probably benign
R0391:Cyp2c54 UTSW 19 40072169 missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40047555 missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40047635 missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40046185 missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40047588 missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40070343 missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40072423 missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40046255 missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40072171 missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40038259 missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40072141 missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40072474 missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40072414 missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40073762 missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40047561 missense probably benign
R6754:Cyp2c54 UTSW 19 40071560 missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40070259 missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40046192 missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40046182 missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40070253 nonsense probably null
R7535:Cyp2c54 UTSW 19 40070272 missense probably benign
R7838:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40073732 frame shift probably null
R8275:Cyp2c54 UTSW 19 40038305 missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40072387 missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40073681 missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40070264 missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40071546 missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40038413 missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40047586 missense probably damaging 0.99
Z1176:Cyp2c54 UTSW 19 40046215 missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40073757 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGGAATCCAGAACACATATTCTCTAC -3'
(R):5'- TGTTGGCCACAAAATGAAGTTATCC -3'

Sequencing Primer
(F):5'- CTTTTATTAGTCACCCTCCTCATTAC -3'
(R):5'- TTGGTGGGACAGAGTCAA -3'
Posted On2019-06-26