Incidental Mutation 'R7317:Stau2'
ID563439
Institutional Source Beutler Lab
Gene Symbol Stau2
Ensembl Gene ENSMUSG00000025920
Gene Namestaufen double-stranded RNA binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location16228674-16520112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16460329 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 122 (H122L)
Ref Sequence ENSEMBL: ENSMUSP00000111016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027052] [ENSMUST00000054668] [ENSMUST00000115359] [ENSMUST00000127420] [ENSMUST00000128957] [ENSMUST00000131257] [ENSMUST00000144138] [ENSMUST00000145092] [ENSMUST00000149320] [ENSMUST00000151888] [ENSMUST00000153966] [ENSMUST00000159558] [ENSMUST00000162007] [ENSMUST00000162435] [ENSMUST00000162627] [ENSMUST00000162751]
Predicted Effect probably benign
Transcript: ENSMUST00000027052
SMART Domains Protein: ENSMUSP00000027052
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000054668
SMART Domains Protein: ENSMUSP00000053190
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 6e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000115359
AA Change: H122L
SMART Domains Protein: ENSMUSP00000111016
Gene: ENSMUSG00000025920
AA Change: H122L

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
low complexity region 76 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127420
SMART Domains Protein: ENSMUSP00000122116
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-4 SMART
Blast:DSRM 5 42 9e-17 BLAST
Blast:DSRM 64 110 2e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128957
SMART Domains Protein: ENSMUSP00000122410
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131257
SMART Domains Protein: ENSMUSP00000121410
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 1 34 9e-3 SMART
DSRM 58 142 2.36e-7 SMART
DSRM 170 235 1.84e-18 SMART
DSRM 270 336 5.45e-21 SMART
low complexity region 409 427 N/A INTRINSIC
PDB:4DKK|A 428 473 2e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000144138
AA Change: H122L
SMART Domains Protein: ENSMUSP00000119130
Gene: ENSMUSG00000025920
AA Change: H122L

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
low complexity region 76 94 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000145092
AA Change: H90L
SMART Domains Protein: ENSMUSP00000115041
Gene: ENSMUSG00000025920
AA Change: H90L

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 1e-4 SMART
Blast:DSRM 5 42 1e-16 BLAST
low complexity region 44 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149320
SMART Domains Protein: ENSMUSP00000118489
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151888
SMART Domains Protein: ENSMUSP00000125473
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
Blast:DSRM 1 55 3e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153966
SMART Domains Protein: ENSMUSP00000117537
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159558
SMART Domains Protein: ENSMUSP00000125726
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162007
SMART Domains Protein: ENSMUSP00000124303
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162435
SMART Domains Protein: ENSMUSP00000123827
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162627
SMART Domains Protein: ENSMUSP00000123781
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162751
SMART Domains Protein: ENSMUSP00000124505
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
Pfam:Staufen_C 455 523 6.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Stau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Stau2 APN 1 16345698 makesense probably null
IGL01809:Stau2 APN 1 16440315 splice site probably null
IGL01895:Stau2 APN 1 16345937 missense probably damaging 0.99
IGL02164:Stau2 APN 1 16345828 missense probably damaging 1.00
IGL02507:Stau2 APN 1 16486069 missense possibly damaging 0.93
R0124:Stau2 UTSW 1 16463128 missense probably damaging 1.00
R0595:Stau2 UTSW 1 16440450 missense probably damaging 1.00
R1104:Stau2 UTSW 1 16440361 nonsense probably null
R1296:Stau2 UTSW 1 16440372 missense probably benign
R1359:Stau2 UTSW 1 16392566 missense probably damaging 1.00
R2884:Stau2 UTSW 1 16231066 missense possibly damaging 0.81
R4066:Stau2 UTSW 1 16394059 missense possibly damaging 0.83
R4718:Stau2 UTSW 1 16346045 intron probably null
R5496:Stau2 UTSW 1 16390021 missense probably damaging 1.00
R6232:Stau2 UTSW 1 16374811 missense probably benign 0.00
R6447:Stau2 UTSW 1 16389825 missense possibly damaging 0.92
R6964:Stau2 UTSW 1 16390005 missense probably damaging 1.00
R7885:Stau2 UTSW 1 16460353 missense unknown
R7968:Stau2 UTSW 1 16460353 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACTGCTACTAGGGTGCACCAG -3'
(R):5'- GTTGCCAAGCTGAATAGGCTC -3'

Sequencing Primer
(F):5'- GCAGTACTGATGATCCTAGGTTCAC -3'
(R):5'- GCCAAGCTGAATAGGCTCTTCTAAG -3'
Posted On2019-06-26