Mutagenetix > Incidental Mutations

Incidental Mutation 'R7317:Tgm3'

563447

Institutional Source

Beutler Lab

Gene Symbol

Tgm3

Ensembl Gene

ENSMUSG00000027401

Gene Name

transglutaminase 3, E polypeptide

Synonyms

TG E

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7317 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130012349-130050399 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 130048291 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 658 (R658Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110299]

Predicted Effect

probably benign
Transcript: ENSMUST00000110299
AA Change: R658Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: R658Q

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,263,647	V200A	probably benign	Het
Adam22	G	A	5: 8,090,202	P832L	probably benign	Het
Adamts17	C	T	7: 66,840,556	R129*	probably null	Het
Alg5	G	T	3: 54,749,331	R321L	probably benign	Het
Amotl1	T	A	9: 14,575,219	T460S	probably benign	Het
Ankrd50	T	C	3: 38,483,183	E7G	possibly damaging	Het
Ap3b2	T	C	7: 81,461,028	T1000A	unknown	Het
Arap2	G	A	5: 62,649,724	T1200M	probably damaging	Het
Asb2	A	T	12: 103,333,357	I272N	probably damaging	Het
Bicd2	T	C	13: 49,378,308	L342P	probably damaging	Het
C1qtnf6	T	A	15: 78,525,006	I214F	probably damaging	Het
Cdc42bpg	T	A	19: 6,314,504	H587Q	probably benign	Het
Cfap70	T	A	14: 20,400,434	I1010F	possibly damaging	Het
Chd1	A	T	17: 15,742,274	K764N	possibly damaging	Het
Cluh	A	G	11: 74,665,704	D956G	possibly damaging	Het
Ehbp1l1	T	C	19: 5,720,702	D243G	probably benign	Het
Ercc4	T	C	16: 13,122,113	V169A	probably benign	Het
Erich6	T	C	3: 58,636,884	E94G	probably benign	Het
Fam109a	A	T	5: 121,853,273	T233S	possibly damaging	Het
Fam46a	G	C	9: 85,324,617	A376G	possibly damaging	Het
Fubp3	A	G	2: 31,604,612		probably null	Het
Gabbr1	C	T	17: 37,069,413	T736I	probably damaging	Het
Gm14496	T	A	2: 181,995,820	M229K	possibly damaging	Het
Gm4553	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	7: 142,165,420		probably benign	Het
Gspt1	T	C	16: 11,222,657	T596A	probably benign	Het
Hist1h1e	A	G	13: 23,622,367	I44T	probably damaging	Het
Htr5b	T	A	1: 121,510,428	Y358F	probably damaging	Het
Il18r1	A	T	1: 40,474,832	Y66F	possibly damaging	Het
Il18rap	A	G	1: 40,525,376	T189A	probably damaging	Het
Itgav	G	T	2: 83,794,983	A771S	probably benign	Het
Klf11	T	C	12: 24,655,519	V324A	possibly damaging	Het
Krtap15	T	C	16: 88,829,305	C87R	probably benign	Het
Lrmp	G	A	6: 145,158,698	G164R	possibly damaging	Het
Mapk8ip3	C	T	17: 24,901,718	G807D	probably benign	Het
Mbd5	A	G	2: 49,279,743	D1642G	probably benign	Het
Med15	G	T	16: 17,671,643	Q356K	unknown	Het
Mmp3	A	G	9: 7,446,937	Y39C	probably damaging	Het
Mon2	A	G	10: 123,013,946	S1149P	probably damaging	Het
Msh3	A	G	13: 92,286,004	I548T	probably damaging	Het
Noc2l	T	A	4: 156,239,216	V179E	possibly damaging	Het
Olfr1272	A	T	2: 90,282,404	M57K	probably damaging	Het
Olfr195	T	G	16: 59,149,321	M157R	possibly damaging	Het
Olfr488	G	T	7: 108,255,218	Q307K	probably benign	Het
Oxa1l	A	T	14: 54,360,855	M1L	probably benign	Het
Pcdhb10	A	T	18: 37,413,026	Q385L	possibly damaging	Het
Pdzd2	T	C	15: 12,592,243	K105R	probably damaging	Het
Pex1	A	T	5: 3,618,875	D582V	probably damaging	Het
Pi4ka	A	G	16: 17,405,632		probably null	Het
Pigw	T	C	11: 84,877,240	N421S	probably benign	Het
Plek	T	C	11: 16,994,739	K97R	probably benign	Het
R3hcc1l	C	T	19: 42,583,540	R753*	probably null	Het
R3hdml	G	A	2: 163,502,447	W252*	probably null	Het
Sept12	T	C	16: 4,991,735	K238E	probably damaging	Het
Sgce	G	A	6: 4,691,615	T320I	probably benign	Het
Sidt2	A	T	9: 45,943,690	C562*	probably null	Het
Skint8	T	C	4: 111,939,520	C274R	possibly damaging	Het
Slc13a5	A	T	11: 72,245,127	M529K	probably damaging	Het
Smg8	T	G	11: 87,085,565	S397R	possibly damaging	Het
Spock3	G	T	8: 63,113,556	R68L	possibly damaging	Het
Stau2	T	A	1: 16,460,329	H122L	unknown	Het
Tert	G	A	13: 73,642,376	R858H	probably damaging	Het
Tmc4	A	G	7: 3,669,919	I455T	probably benign	Het
Tmtc4	G	A	14: 122,978,181	P18S	probably benign	Het
Tnc	A	G	4: 63,972,722	I1641T	probably damaging	Het
Trav14-3	A	T	14: 53,763,494	N54I	probably damaging	Het
Ttll13	A	C	7: 80,254,163	K280Q	probably damaging	Het
Unc5c	T	A	3: 141,789,942	M524K	probably benign	Het
Unc93a	A	G	17: 13,116,284	F292L	probably benign	Het
Uso1	A	G	5: 92,173,992	N248S	possibly damaging	Het
Usp5	A	G	6: 124,826,318	L73P	probably damaging	Het
Utp20	T	A	10: 88,762,935	I60F	possibly damaging	Het
Vmn2r94	T	A	17: 18,243,620	I803F	probably benign	Het

Other mutations in Tgm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Tgm3	APN	2	130038413	missense	probably damaging	1.00
IGL00924:Tgm3	APN	2	130038374	missense	probably damaging	1.00
IGL01469:Tgm3	APN	2	130024494	missense	probably damaging	1.00
IGL01722:Tgm3	APN	2	130044568	missense	probably damaging	0.99
IGL01787:Tgm3	APN	2	130047740	missense	possibly damaging	0.85
IGL02269:Tgm3	APN	2	130024518	missense	probably benign	0.02
IGL02437:Tgm3	APN	2	130030041	splice site	probably null
IGL02449:Tgm3	APN	2	130038609	critical splice donor site	probably null
IGL02992:Tgm3	APN	2	130041979	missense	probably damaging	1.00
tortellini	UTSW	2	130024585	critical splice donor site	probably benign
ANU74:Tgm3	UTSW	2	130048390	missense	probably damaging	1.00
R0523:Tgm3	UTSW	2	130044662	critical splice donor site	probably null
R0833:Tgm3	UTSW	2	130026682	splice site	probably benign
R0834:Tgm3	UTSW	2	130026757	missense	probably benign	0.00
R0836:Tgm3	UTSW	2	130026682	splice site	probably benign
R0940:Tgm3	UTSW	2	130012406	missense	probably benign	0.00
R1354:Tgm3	UTSW	2	130041898	missense	probably benign
R1642:Tgm3	UTSW	2	130047782	missense	probably damaging	1.00
R1670:Tgm3	UTSW	2	130041768	nonsense	probably null
R1715:Tgm3	UTSW	2	130026814	critical splice donor site	probably null
R1944:Tgm3	UTSW	2	130029969	missense	probably damaging	0.99
R2104:Tgm3	UTSW	2	130037483	missense	probably benign	0.39
R3416:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R3417:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R4231:Tgm3	UTSW	2	130044589	nonsense	probably null
R4296:Tgm3	UTSW	2	130038413	missense	possibly damaging	0.77
R4794:Tgm3	UTSW	2	130041955	missense	probably benign	0.00
R4948:Tgm3	UTSW	2	130048320	missense	probably benign	0.00
R5034:Tgm3	UTSW	2	130037484	missense	possibly damaging	0.95
R5144:Tgm3	UTSW	2	130048282	missense	possibly damaging	0.95
R5786:Tgm3	UTSW	2	130026784	nonsense	probably null
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6182:Tgm3	UTSW	2	130025301	nonsense	probably null
R6219:Tgm3	UTSW	2	130038610	critical splice donor site	probably null
R6901:Tgm3	UTSW	2	130041970	missense	possibly damaging	0.95
R6969:Tgm3	UTSW	2	130042029	missense	probably benign	0.06
R6980:Tgm3	UTSW	2	130026777	missense	probably benign	0.17
R7282:Tgm3	UTSW	2	130024561	missense	probably benign	0.00
R7513:Tgm3	UTSW	2	130024404	missense	probably benign	0.00
R7517:Tgm3	UTSW	2	130041764	missense	probably benign	0.01
R7793:Tgm3	UTSW	2	130012410	critical splice donor site	probably null
R7822:Tgm3	UTSW	2	130041899	missense	probably benign	0.00
R7955:Tgm3	UTSW	2	130038480	missense	probably benign
X0065:Tgm3	UTSW	2	130024510	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CTGGCTGTCACAGAGTCAAAGG -3'
(R):5'- GGCAACAGTTTCACTCCACAGG -3'

Sequencing Primer
(F):5'- CTGTCACAGAGTCAAAGGGAACC -3'
(R):5'- ACAGGAGAGCGCTGTCTG -3'

Posted On

2019-06-26