Incidental Mutation 'R7317:Tgm3'
ID563447
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130048291 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 658 (R658Q)
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect probably benign
Transcript: ENSMUST00000110299
AA Change: R658Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: R658Q

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7822:Tgm3 UTSW 2 130041899 missense probably benign 0.00
R7955:Tgm3 UTSW 2 130038480 missense probably benign
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGGCTGTCACAGAGTCAAAGG -3'
(R):5'- GGCAACAGTTTCACTCCACAGG -3'

Sequencing Primer
(F):5'- CTGTCACAGAGTCAAAGGGAACC -3'
(R):5'- ACAGGAGAGCGCTGTCTG -3'
Posted On2019-06-26