Incidental Mutation 'R7317:Unc5c'
ID563453
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141789942 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 524 (M524K)
Ref Sequence ENSEMBL: ENSMUSP00000074758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably benign
Transcript: ENSMUST00000075282
AA Change: M524K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: M524K

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106236
AA Change: M505K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: M505K

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130636
AA Change: M450K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: M450K

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142762
AA Change: M524K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: M524K

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7936:Unc5c UTSW 3 141828477 missense possibly damaging 0.48
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141768612 critical splice donor site probably null
R8669:Unc5c UTSW 3 141803943 missense possibly damaging 0.91
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCCTCAGATCTCCTGG -3'
(R):5'- TATGACTTCAAGCTGCATCTTTGTC -3'

Sequencing Primer
(F):5'- TCAGCTGCAGCCATGTACAG -3'
(R):5'- GCATCTTTGTCACTTAAATTTTCAGG -3'
Posted On2019-06-26