Incidental Mutation 'R0579:Il21'
ID 56346
Institutional Source Beutler Lab
Gene Symbol Il21
Ensembl Gene ENSMUSG00000027718
Gene Name interleukin 21
Synonyms
MMRRC Submission 038769-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0579 (G1)
Quality Score 145
Status Validated
Chromosome 3
Chromosomal Location 37222759-37232636 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 37227774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamine at position 74 (K74Q)
Ref Sequence ENSEMBL: ENSMUSP00000124668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]
AlphaFold Q9ES17
Predicted Effect possibly damaging
Transcript: ENSMUST00000029273
AA Change: K74Q

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: K74Q

DomainStartEndE-ValueType
Pfam:IL15 4 142 7.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147691
Predicted Effect possibly damaging
Transcript: ENSMUST00000161015
AA Change: K74Q

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: K74Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
PDB:3TGX|P 39 140 8e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196943
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Abcf3 G A 16: 20,550,648 R260Q probably benign Het
Abcg3 A G 5: 104,974,103 V136A probably damaging Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Ambra1 A G 2: 91,824,465 N783S possibly damaging Het
Cd300ld2 A G 11: 115,012,299 F240S probably benign Het
Cep83 A G 10: 94,749,053 D340G possibly damaging Het
Crybg2 T A 4: 134,072,738 I403N probably damaging Het
Dnah14 T A 1: 181,744,747 M2881K possibly damaging Het
Erbb4 T C 1: 68,042,462 M1138V probably benign Het
Evi5 A G 5: 107,821,709 V112A probably benign Het
F2r A G 13: 95,618,349 V9A probably benign Het
Flot1 C A 17: 35,831,008 S337R probably benign Het
Glt28d2 G A 3: 85,872,133 T11I probably damaging Het
Gm19345 A G 7: 19,854,976 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Hmgcs2 A T 3: 98,290,948 I56F probably damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itpripl1 G T 2: 127,141,091 Y370* probably null Het
Kif24 G A 4: 41,393,706 P1056S probably damaging Het
L2hgdh A T 12: 69,701,272 probably benign Het
Lipo2 A T 19: 33,746,898 L156Q probably damaging Het
Nlrp4c T A 7: 6,060,845 M84K probably benign Het
Npy4r G A 14: 34,146,683 T216I probably benign Het
Olfr109 T C 17: 37,466,347 V47A probably benign Het
Olfr802 A T 10: 129,682,237 C167* probably null Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pafah1b2 T C 9: 45,968,713 E222G probably benign Het
Pop1 T A 15: 34,509,969 D406E possibly damaging Het
Proser1 A G 3: 53,467,151 Y32C probably damaging Het
Ptprj C A 2: 90,436,569 probably null Het
Slc1a3 T A 15: 8,688,309 I100F probably damaging Het
Slc25a22 T C 7: 141,431,359 D176G probably damaging Het
Stard7 T C 2: 127,284,553 V99A probably damaging Het
Stk33 C T 7: 109,325,697 V184I probably damaging Het
Timmdc1 A G 16: 38,522,383 L51P probably benign Het
Tppp T C 13: 74,021,233 S31P probably benign Het
Upf2 A T 2: 5,988,429 R599W unknown Het
Vav1 G T 17: 57,279,271 W25L probably benign Het
Other mutations in Il21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0433:Il21 UTSW 3 37232535 missense possibly damaging 0.46
R1641:Il21 UTSW 3 37232532 missense probably benign 0.00
R1741:Il21 UTSW 3 37227662 missense probably benign 0.00
R1754:Il21 UTSW 3 37225525 missense possibly damaging 0.93
R1933:Il21 UTSW 3 37232486 missense probably benign
R4560:Il21 UTSW 3 37225484 nonsense probably null
R4975:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4977:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4979:Il21 UTSW 3 37232504 missense probably damaging 0.99
R5254:Il21 UTSW 3 37227735 missense possibly damaging 0.94
R5267:Il21 UTSW 3 37227797 missense probably benign
R5641:Il21 UTSW 3 37227768 nonsense probably null
R7058:Il21 UTSW 3 37232480 missense probably damaging 1.00
R7259:Il21 UTSW 3 37227654 critical splice donor site probably null
R9039:Il21 UTSW 3 37232453 missense probably benign
R9249:Il21 UTSW 3 37225528 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTCCATGCTAGTGATAACTGCG -3'
(R):5'- GAGTGACTTCAGCATAGCACCAGG -3'

Sequencing Primer
(F):5'- CATGCTAGTGATAACTGCGAACAAG -3'
(R):5'- TTTTCTCCCAGACAGGGAAGC -3'
Posted On 2013-07-11