Incidental Mutation 'R7317:Uso1'
ID563460
Institutional Source Beutler Lab
Gene Symbol Uso1
Ensembl Gene ENSMUSG00000029407
Gene NameUSO1 vesicle docking factor
SynonymsVdp, TAP, transcytosis associated protein p115
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location92137938-92202798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92173992 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 248 (N248S)
Ref Sequence ENSEMBL: ENSMUSP00000031355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031355
AA Change: N248S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: N248S

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 6.5e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
Pfam:Uso1_p115_C 782 954 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201642
SMART Domains Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
PDB:3GRL|A 1 52 5e-24 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000202155
AA Change: N248S

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407
AA Change: N248S

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 5.7e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Pfam:Uso1_p115_C 730 892 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Uso1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Uso1 APN 5 92181419 missense probably damaging 0.96
IGL01753:Uso1 APN 5 92152918 critical splice donor site probably null
IGL02311:Uso1 APN 5 92187776 missense probably benign
IGL02539:Uso1 APN 5 92187773 missense probably damaging 1.00
IGL02716:Uso1 APN 5 92173935 missense probably damaging 0.99
IGL03154:Uso1 APN 5 92180618 nonsense probably null
R0558:Uso1 UTSW 5 92174019 missense probably benign 0.03
R0570:Uso1 UTSW 5 92199823 missense probably benign 0.19
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1398:Uso1 UTSW 5 92181468 missense probably benign 0.16
R1485:Uso1 UTSW 5 92180563 missense possibly damaging 0.76
R1813:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1873:Uso1 UTSW 5 92192859 splice site probably benign
R1896:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1899:Uso1 UTSW 5 92201192 missense probably benign 0.27
R2049:Uso1 UTSW 5 92181936 missense probably damaging 1.00
R2128:Uso1 UTSW 5 92195370 missense probably benign
R2411:Uso1 UTSW 5 92158399 splice site probably benign
R2903:Uso1 UTSW 5 92195435 critical splice donor site probably null
R5055:Uso1 UTSW 5 92192735 missense probably benign 0.31
R5155:Uso1 UTSW 5 92167335 critical splice donor site probably null
R5590:Uso1 UTSW 5 92180608 missense probably benign 0.05
R5665:Uso1 UTSW 5 92198337 missense possibly damaging 0.95
R5677:Uso1 UTSW 5 92201299 missense probably damaging 1.00
R5996:Uso1 UTSW 5 92192730 missense probably benign 0.00
R6165:Uso1 UTSW 5 92187267 missense probably damaging 1.00
R6340:Uso1 UTSW 5 92199852 missense probably benign 0.01
R6701:Uso1 UTSW 5 92166585 missense probably damaging 1.00
R6860:Uso1 UTSW 5 92195348 missense probably benign 0.11
R7062:Uso1 UTSW 5 92192740 missense possibly damaging 0.62
R7133:Uso1 UTSW 5 92158465 missense probably benign 0.12
R7527:Uso1 UTSW 5 92199875 missense possibly damaging 0.58
R7648:Uso1 UTSW 5 92194002 splice site probably null
R7707:Uso1 UTSW 5 92201936 makesense probably null
R8009:Uso1 UTSW 5 92166580 missense probably benign 0.03
Z1177:Uso1 UTSW 5 92138130 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAAGGTGGCAGCTCAGAAC -3'
(R):5'- CTGAAAACCCTGGGTTGAAAACTG -3'

Sequencing Primer
(F):5'- TGGCAGCTCAGAACAGGCTG -3'
(R):5'- CTGAAGCAATTTAACTTTTGTGGG -3'
Posted On2019-06-26