Incidental Mutation 'R0579:Proser1'
ID 56347
Institutional Source Beutler Lab
Gene Symbol Proser1
Ensembl Gene ENSMUSG00000049504
Gene Name proline and serine rich 1
Synonyms 2810046L04Rik
MMRRC Submission 038769-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0579 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 53371216-53389176 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53374572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 32 (Y32C)
Ref Sequence ENSEMBL: ENSMUSP00000055253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056749] [ENSMUST00000058577] [ENSMUST00000130348]
AlphaFold Q5PRE5
Predicted Effect probably benign
Transcript: ENSMUST00000056749
SMART Domains Protein: ENSMUSP00000055295
Gene: ENSMUSG00000042997

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:NHL 213 240 1.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058577
AA Change: Y32C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055253
Gene: ENSMUSG00000049504
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:DUF4476 1 63 5e-12 PFAM
Pfam:DUF4476 30 121 4e-27 PFAM
low complexity region 227 246 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 696 718 N/A INTRINSIC
low complexity region 781 804 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 820 834 N/A INTRINSIC
low complexity region 854 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130348
SMART Domains Protein: ENSMUSP00000114215
Gene: ENSMUSG00000042997

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198983
Meta Mutation Damage Score 0.2152 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein containing proline and serine rich regions. These regions may be important in protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,839,412 (GRCm39) probably null Het
Abcf3 G A 16: 20,369,398 (GRCm39) R260Q probably benign Het
Abcg3 A G 5: 105,121,969 (GRCm39) V136A probably damaging Het
Acr C G 15: 89,453,678 (GRCm39) H72Q probably damaging Het
Ambra1 A G 2: 91,654,810 (GRCm39) N783S possibly damaging Het
Cd300ld2 A G 11: 114,903,125 (GRCm39) F240S probably benign Het
Cep83 A G 10: 94,584,915 (GRCm39) D340G possibly damaging Het
Crybg2 T A 4: 133,800,049 (GRCm39) I403N probably damaging Het
Dnah14 T A 1: 181,572,312 (GRCm39) M2881K possibly damaging Het
Erbb4 T C 1: 68,081,621 (GRCm39) M1138V probably benign Het
Evi5 A G 5: 107,969,575 (GRCm39) V112A probably benign Het
F2r A G 13: 95,754,857 (GRCm39) V9A probably benign Het
Flot1 C A 17: 36,141,900 (GRCm39) S337R probably benign Het
Glt28d2 G A 3: 85,779,440 (GRCm39) T11I probably damaging Het
Gm19345 A G 7: 19,588,901 (GRCm39) probably benign Het
Gm6605 C A 7: 38,147,699 (GRCm39) noncoding transcript Het
Hmgcs2 A T 3: 98,198,264 (GRCm39) I56F probably damaging Het
Ifna9 T A 4: 88,510,508 (GRCm39) T39S possibly damaging Het
Il21 T G 3: 37,281,923 (GRCm39) K74Q possibly damaging Het
Itpripl1 G T 2: 126,983,011 (GRCm39) Y370* probably null Het
Kif24 G A 4: 41,393,706 (GRCm39) P1056S probably damaging Het
L2hgdh A T 12: 69,748,046 (GRCm39) probably benign Het
Lipo2 A T 19: 33,724,298 (GRCm39) L156Q probably damaging Het
Nlrp4c T A 7: 6,063,844 (GRCm39) M84K probably benign Het
Npy4r G A 14: 33,868,640 (GRCm39) T216I probably benign Het
Or12d17 T C 17: 37,777,238 (GRCm39) V47A probably benign Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or6c1 A T 10: 129,518,106 (GRCm39) C167* probably null Het
Pafah1b2 T C 9: 45,880,011 (GRCm39) E222G probably benign Het
Pop1 T A 15: 34,510,115 (GRCm39) D406E possibly damaging Het
Ptprj C A 2: 90,266,913 (GRCm39) probably null Het
Slc1a3 T A 15: 8,717,793 (GRCm39) I100F probably damaging Het
Slc25a22 T C 7: 141,011,272 (GRCm39) D176G probably damaging Het
Stard7 T C 2: 127,126,473 (GRCm39) V99A probably damaging Het
Stk33 C T 7: 108,924,904 (GRCm39) V184I probably damaging Het
Timmdc1 A G 16: 38,342,745 (GRCm39) L51P probably benign Het
Tppp T C 13: 74,169,352 (GRCm39) S31P probably benign Het
Upf2 A T 2: 5,993,240 (GRCm39) R599W unknown Het
Vav1 G T 17: 57,586,271 (GRCm39) W25L probably benign Het
Other mutations in Proser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Proser1 APN 3 53,386,251 (GRCm39) missense probably benign 0.00
IGL02217:Proser1 APN 3 53,378,912 (GRCm39) missense probably damaging 0.96
IGL02260:Proser1 APN 3 53,386,365 (GRCm39) missense probably damaging 1.00
IGL02943:Proser1 APN 3 53,386,524 (GRCm39) missense probably damaging 0.98
donatello UTSW 3 53,374,572 (GRCm39) missense probably damaging 1.00
R0166:Proser1 UTSW 3 53,388,038 (GRCm39) missense possibly damaging 0.89
R0230:Proser1 UTSW 3 53,386,383 (GRCm39) missense probably damaging 0.99
R0599:Proser1 UTSW 3 53,386,485 (GRCm39) missense probably benign 0.04
R0616:Proser1 UTSW 3 53,382,118 (GRCm39) missense probably damaging 0.98
R0622:Proser1 UTSW 3 53,385,281 (GRCm39) missense probably benign 0.22
R0629:Proser1 UTSW 3 53,386,485 (GRCm39) missense probably benign 0.04
R0707:Proser1 UTSW 3 53,386,197 (GRCm39) missense probably damaging 1.00
R1568:Proser1 UTSW 3 53,385,180 (GRCm39) missense possibly damaging 0.54
R1997:Proser1 UTSW 3 53,386,292 (GRCm39) missense probably benign 0.10
R2129:Proser1 UTSW 3 53,385,366 (GRCm39) missense probably benign 0.20
R2207:Proser1 UTSW 3 53,385,812 (GRCm39) missense probably benign 0.00
R2851:Proser1 UTSW 3 53,387,966 (GRCm39) missense probably benign 0.07
R4077:Proser1 UTSW 3 53,385,962 (GRCm39) missense probably damaging 1.00
R4093:Proser1 UTSW 3 53,387,133 (GRCm39) critical splice donor site probably null
R4970:Proser1 UTSW 3 53,371,727 (GRCm39) missense probably damaging 1.00
R4988:Proser1 UTSW 3 53,387,046 (GRCm39) missense probably damaging 0.98
R5611:Proser1 UTSW 3 53,386,296 (GRCm39) missense probably benign 0.10
R6090:Proser1 UTSW 3 53,386,088 (GRCm39) missense probably benign 0.00
R6146:Proser1 UTSW 3 53,385,540 (GRCm39) missense probably damaging 1.00
R6459:Proser1 UTSW 3 53,385,750 (GRCm39) missense possibly damaging 0.51
R6880:Proser1 UTSW 3 53,385,260 (GRCm39) missense probably benign
R7308:Proser1 UTSW 3 53,386,125 (GRCm39) missense probably benign 0.40
R7456:Proser1 UTSW 3 53,385,939 (GRCm39) missense probably damaging 0.99
R7787:Proser1 UTSW 3 53,380,969 (GRCm39) missense probably damaging 1.00
R7903:Proser1 UTSW 3 53,386,503 (GRCm39) nonsense probably null
R8108:Proser1 UTSW 3 53,379,509 (GRCm39) critical splice donor site probably null
R8172:Proser1 UTSW 3 53,386,272 (GRCm39) missense possibly damaging 0.73
R8414:Proser1 UTSW 3 53,385,977 (GRCm39) missense probably damaging 1.00
R8677:Proser1 UTSW 3 53,385,122 (GRCm39) missense probably benign 0.01
R9064:Proser1 UTSW 3 53,384,927 (GRCm39) missense probably damaging 1.00
R9164:Proser1 UTSW 3 53,379,494 (GRCm39) missense probably benign 0.03
R9555:Proser1 UTSW 3 53,378,876 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CAGCCAGCTCTCTATCAGGTTTCCA -3'
(R):5'- CGTTTGATATTTCCCCAGAATAAGTGACAGT -3'

Sequencing Primer
(F):5'- gcttcatagtgagcccgc -3'
(R):5'- AGTCAAAGCAACCCTGAACG -3'
Posted On 2013-07-11