Incidental Mutation 'R7317:Fam46a'
ID563476
Institutional Source Beutler Lab
Gene Symbol Fam46a
Ensembl Gene ENSMUSG00000032265
Gene Namefamily with sequence similarity 46, member A
SynonymsD930050G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location85320439-85327348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 85324617 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 376 (A376G)
Ref Sequence ENSEMBL: ENSMUSP00000140869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034802] [ENSMUST00000187711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034802
AA Change: A395G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034802
Gene: ENSMUSG00000032265
AA Change: A395G

DomainStartEndE-ValueType
low complexity region 43 55 N/A INTRINSIC
DUF1693 71 389 8.01e-244 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187711
AA Change: A376G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140869
Gene: ENSMUSG00000032265
AA Change: A376G

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
DUF1693 52 370 3.9e-248 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show partial lethality, high alkaline phosphatase (ALP) activity, short stature, and limb, long bone, rib, pelvis and skull anomalies, with absent trabeculae and reduced cortical thickness in long bones. Heterozygotes show high ALP activity but no other defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Fam46a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Fam46a APN 9 85324753 missense possibly damaging 0.94
IGL01135:Fam46a APN 9 85326599 missense probably damaging 0.97
IGL01724:Fam46a APN 9 85325050 missense probably damaging 0.99
IGL02798:Fam46a APN 9 85324884 missense probably damaging 1.00
R0482:Fam46a UTSW 9 85325055 missense probably damaging 1.00
R2697:Fam46a UTSW 9 85324740 missense possibly damaging 0.48
R4458:Fam46a UTSW 9 85326474 missense possibly damaging 0.75
R4494:Fam46a UTSW 9 85325047 missense probably damaging 0.99
R5245:Fam46a UTSW 9 85326348 missense possibly damaging 0.46
R6539:Fam46a UTSW 9 85326561 missense possibly damaging 0.75
R6622:Fam46a UTSW 9 85326456 missense probably damaging 0.99
R7253:Fam46a UTSW 9 85326717 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTTACTTGAAATGGCTTCCC -3'
(R):5'- ACTTCTCAGACATCGGAGAGC -3'

Sequencing Primer
(F):5'- GGGCTGAACTTGTGCAAT -3'
(R):5'- CTCAGACATCGGAGAGCAGCAG -3'
Posted On2019-06-26