Mutagenetix > Incidental Mutations

Incidental Mutation 'R7317:Hist1h1e'

563486

Institutional Source

Beutler Lab

Gene Symbol

Hist1h1e

Ensembl Gene

ENSMUSG00000051627

Gene Name

histone cluster 1, H1e

Synonyms

H1-4, H1var2, H1s-4, H1f4, H1e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7317 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23620629-23622558 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23622367 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 44 (I44T)

Ref Sequence

ENSEMBL: ENSMUSP00000057308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000062045] [ENSMUST00000091704]

Predicted Effect

probably benign
Transcript: ENSMUST00000051091

SMART Domains

Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
H2B	28	124	1.43e-72	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000062045
AA Change: I44T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000057308
Gene: ENSMUSG00000051627
AA Change: I44T

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
H15	34	99	7.5e-23	SMART
low complexity region	116	219	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000091704

SMART Domains

Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
H2B	28	124	1.43e-72	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1e/Hist1h1c double knockout males are significantly smaller than normal. The Hist1h1e/Hist1h1d/Hist1h1e triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,263,647	V200A	probably benign	Het
Adam22	G	A	5: 8,090,202	P832L	probably benign	Het
Adamts17	C	T	7: 66,840,556	R129*	probably null	Het
Alg5	G	T	3: 54,749,331	R321L	probably benign	Het
Amotl1	T	A	9: 14,575,219	T460S	probably benign	Het
Ankrd50	T	C	3: 38,483,183	E7G	possibly damaging	Het
Ap3b2	T	C	7: 81,461,028	T1000A	unknown	Het
Arap2	G	A	5: 62,649,724	T1200M	probably damaging	Het
Asb2	A	T	12: 103,333,357	I272N	probably damaging	Het
Bicd2	T	C	13: 49,378,308	L342P	probably damaging	Het
C1qtnf6	T	A	15: 78,525,006	I214F	probably damaging	Het
Cdc42bpg	T	A	19: 6,314,504	H587Q	probably benign	Het
Cfap70	T	A	14: 20,400,434	I1010F	possibly damaging	Het
Chd1	A	T	17: 15,742,274	K764N	possibly damaging	Het
Cluh	A	G	11: 74,665,704	D956G	possibly damaging	Het
Ehbp1l1	T	C	19: 5,720,702	D243G	probably benign	Het
Ercc4	T	C	16: 13,122,113	V169A	probably benign	Het
Erich6	T	C	3: 58,636,884	E94G	probably benign	Het
Fam109a	A	T	5: 121,853,273	T233S	possibly damaging	Het
Fam46a	G	C	9: 85,324,617	A376G	possibly damaging	Het
Fubp3	A	G	2: 31,604,612		probably null	Het
Gabbr1	C	T	17: 37,069,413	T736I	probably damaging	Het
Gm14496	T	A	2: 181,995,820	M229K	possibly damaging	Het
Gm4553	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	7: 142,165,420		probably benign	Het
Gspt1	T	C	16: 11,222,657	T596A	probably benign	Het
Htr5b	T	A	1: 121,510,428	Y358F	probably damaging	Het
Il18r1	A	T	1: 40,474,832	Y66F	possibly damaging	Het
Il18rap	A	G	1: 40,525,376	T189A	probably damaging	Het
Itgav	G	T	2: 83,794,983	A771S	probably benign	Het
Klf11	T	C	12: 24,655,519	V324A	possibly damaging	Het
Krtap15	T	C	16: 88,829,305	C87R	probably benign	Het
Lrmp	G	A	6: 145,158,698	G164R	possibly damaging	Het
Mapk8ip3	C	T	17: 24,901,718	G807D	probably benign	Het
Mbd5	A	G	2: 49,279,743	D1642G	probably benign	Het
Med15	G	T	16: 17,671,643	Q356K	unknown	Het
Mmp3	A	G	9: 7,446,937	Y39C	probably damaging	Het
Mon2	A	G	10: 123,013,946	S1149P	probably damaging	Het
Msh3	A	G	13: 92,286,004	I548T	probably damaging	Het
Noc2l	T	A	4: 156,239,216	V179E	possibly damaging	Het
Olfr1272	A	T	2: 90,282,404	M57K	probably damaging	Het
Olfr195	T	G	16: 59,149,321	M157R	possibly damaging	Het
Olfr488	G	T	7: 108,255,218	Q307K	probably benign	Het
Oxa1l	A	T	14: 54,360,855	M1L	probably benign	Het
Pcdhb10	A	T	18: 37,413,026	Q385L	possibly damaging	Het
Pdzd2	T	C	15: 12,592,243	K105R	probably damaging	Het
Pex1	A	T	5: 3,618,875	D582V	probably damaging	Het
Pi4ka	A	G	16: 17,405,632		probably null	Het
Pigw	T	C	11: 84,877,240	N421S	probably benign	Het
Plek	T	C	11: 16,994,739	K97R	probably benign	Het
R3hcc1l	C	T	19: 42,583,540	R753*	probably null	Het
R3hdml	G	A	2: 163,502,447	W252*	probably null	Het
Sept12	T	C	16: 4,991,735	K238E	probably damaging	Het
Sgce	G	A	6: 4,691,615	T320I	probably benign	Het
Sidt2	A	T	9: 45,943,690	C562*	probably null	Het
Skint8	T	C	4: 111,939,520	C274R	possibly damaging	Het
Slc13a5	A	T	11: 72,245,127	M529K	probably damaging	Het
Smg8	T	G	11: 87,085,565	S397R	possibly damaging	Het
Spock3	G	T	8: 63,113,556	R68L	possibly damaging	Het
Stau2	T	A	1: 16,460,329	H122L	unknown	Het
Tert	G	A	13: 73,642,376	R858H	probably damaging	Het
Tgm3	G	A	2: 130,048,291	R658Q	probably benign	Het
Tmc4	A	G	7: 3,669,919	I455T	probably benign	Het
Tmtc4	G	A	14: 122,978,181	P18S	probably benign	Het
Tnc	A	G	4: 63,972,722	I1641T	probably damaging	Het
Trav14-3	A	T	14: 53,763,494	N54I	probably damaging	Het
Ttll13	A	C	7: 80,254,163	K280Q	probably damaging	Het
Unc5c	T	A	3: 141,789,942	M524K	probably benign	Het
Unc93a	A	G	17: 13,116,284	F292L	probably benign	Het
Uso1	A	G	5: 92,173,992	N248S	possibly damaging	Het
Usp5	A	G	6: 124,826,318	L73P	probably damaging	Het
Utp20	T	A	10: 88,762,935	I60F	possibly damaging	Het
Vmn2r94	T	A	17: 18,243,620	I803F	probably benign	Het

Other mutations in Hist1h1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Hist1h1e	APN	13	23622022	unclassified	probably benign
IGL03354:Hist1h1e	APN	13	23622077	unclassified	probably benign
PIT4469001:Hist1h1e	UTSW	13	23622379	missense	probably damaging	1.00
R2339:Hist1h1e	UTSW	13	23621960	unclassified	probably benign
R3110:Hist1h1e	UTSW	13	23621846	unclassified	probably benign
R3112:Hist1h1e	UTSW	13	23621846	unclassified	probably benign
R3757:Hist1h1e	UTSW	13	23622257	nonsense	probably null
R3758:Hist1h1e	UTSW	13	23622257	nonsense	probably null
R5116:Hist1h1e	UTSW	13	23622287	missense	probably damaging	1.00
R6034:Hist1h1e	UTSW	13	23622313	missense	probably damaging	1.00
R6034:Hist1h1e	UTSW	13	23622313	missense	probably damaging	1.00
R7008:Hist1h1e	UTSW	13	23622209	missense	probably damaging	1.00
R7051:Hist1h1e	UTSW	13	23622439	missense	probably benign	0.00
R8220:Hist1h1e	UTSW	13	23621939	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GAAGCCGCCTTCTTGTTGAG -3'
(R):5'- TCCGCCCTATATAAACGGGC -3'

Sequencing Primer
(F):5'- CCGCCTTCTTGTTGAGTTTGAAG -3'
(R):5'- CCTATATAAACGGGCGGGCG -3'

Posted On

2019-06-26