Incidental Mutation 'R7317:Gspt1'
ID563497
Institutional Source Beutler Lab
Gene Symbol Gspt1
Ensembl Gene ENSMUSG00000062203
Gene NameG1 to S phase transition 1
SynonymsGst-1, G1st, Gst-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location11219292-11254325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11222657 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 596 (T596A)
Ref Sequence ENSEMBL: ENSMUSP00000078940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080030] [ENSMUST00000167571]
PDB Structure
Structure of GSPT1/ERF3A-PABC [SOLUTION NMR]
Structure of GSPT1/ERF3A-PABC [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000080030
AA Change: T596A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078940
Gene: ENSMUSG00000062203
AA Change: T596A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 4.3e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 151 193 N/A INTRINSIC
Pfam:GTP_EFTU 209 482 3.1e-47 PFAM
Pfam:GTP_EFTU_D2 451 518 1.2e-8 PFAM
Pfam:GTP_EFTU_D3 524 632 7.6e-33 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000130959
Gene: ENSMUSG00000062203
AA Change: T59A

DomainStartEndE-ValueType
Pfam:GTP_EFTU_D3 18 96 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167571
AA Change: T595A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130583
Gene: ENSMUSG00000062203
AA Change: T595A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 7.1e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Pfam:GTP_EFTU 208 476 4.3e-49 PFAM
Pfam:GTP_EFTU_D2 450 517 1.3e-7 PFAM
Pfam:GTP_EFTU_D3 523 631 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Gspt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Gspt1 APN 16 11222612 missense probably damaging 0.99
IGL00902:Gspt1 APN 16 11232579 missense probably damaging 1.00
IGL00983:Gspt1 APN 16 11230997 splice site probably benign
IGL01775:Gspt1 APN 16 11223295 missense possibly damaging 0.92
IGL02079:Gspt1 APN 16 11240829 missense probably benign 0.17
IGL02122:Gspt1 APN 16 11229216 missense probably damaging 1.00
IGL02525:Gspt1 APN 16 11230990 missense probably damaging 1.00
IGL03092:Gspt1 APN 16 11238899 missense probably benign 0.11
goliad UTSW 16 11224542 missense probably benign 0.04
R0835:Gspt1 UTSW 16 11238938 missense probably benign
R1519:Gspt1 UTSW 16 11220855 missense probably damaging 1.00
R3410:Gspt1 UTSW 16 11229245 missense probably damaging 1.00
R4834:Gspt1 UTSW 16 11222717 missense probably damaging 1.00
R4866:Gspt1 UTSW 16 11222665 missense possibly damaging 0.69
R5121:Gspt1 UTSW 16 11223301 missense probably damaging 0.99
R5408:Gspt1 UTSW 16 11253855 missense probably benign
R5410:Gspt1 UTSW 16 11230510 missense probably benign 0.00
R5517:Gspt1 UTSW 16 11253979 missense unknown
R5704:Gspt1 UTSW 16 11228193 missense possibly damaging 0.89
R6224:Gspt1 UTSW 16 11224542 missense probably benign 0.04
R6317:Gspt1 UTSW 16 11223208 splice site probably null
R7069:Gspt1 UTSW 16 11222661 missense probably damaging 1.00
R7151:Gspt1 UTSW 16 11253828 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAACAGAACATAAATCTGGGGTTTG -3'
(R):5'- TGAAAAGCTAGCATGCTGTCTG -3'

Sequencing Primer
(F):5'- GTTTGAAATCTACTGCAGTAAGAGC -3'
(R):5'- AGACAGGGTCCCTCTATGTAG -3'
Posted On2019-06-26