Incidental Mutation 'R7317:Pi4ka'
ID563499
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 17405632 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023449] [ENSMUST00000036161] [ENSMUST00000232232]
Predicted Effect probably benign
Transcript: ENSMUST00000023449
SMART Domains Protein: ENSMUSP00000023449
Gene: ENSMUSG00000022765

DomainStartEndE-ValueType
t_SNARE 45 112 1.53e-6 SMART
t_SNARE 193 260 1.39e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036161
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232232
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
dove_bar UTSW 16 17326052 splice site probably null
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
R7581:Pi4ka UTSW 16 17301060 missense
R7622:Pi4ka UTSW 16 17293977 missense
R7717:Pi4ka UTSW 16 17376923 missense
R8048:Pi4ka UTSW 16 17303127 missense
R8052:Pi4ka UTSW 16 17356166 missense
RF007:Pi4ka UTSW 16 17297233 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGATGTCACAGCGGTAGTCC -3'
(R):5'- AGCTTTTAGGATAGCCAGACATG -3'

Sequencing Primer
(F):5'- GTACCAGACCTCCCAGCGTC -3'
(R):5'- ATTCACTGTGGACGCCG -3'
Posted On2019-06-26