Incidental Mutation 'R7246:Bpifb1'
ID563523
Institutional Source Beutler Lab
Gene Symbol Bpifb1
Ensembl Gene ENSMUSG00000027485
Gene NameBPI fold containing family B, member 1
SynonymsLPlunc1, von Ebner minor salivary protein, U46068
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7246 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154190818-154220369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154207092 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 172 (L172P)
Ref Sequence ENSEMBL: ENSMUSP00000028987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028987] [ENSMUST00000081816]
Predicted Effect probably damaging
Transcript: ENSMUST00000028987
AA Change: L172P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028987
Gene: ENSMUSG00000027485
AA Change: L172P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081816
AA Change: L172P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080501
Gene: ENSMUSG00000027485
AA Change: L172P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background sensitive transmission ratio distortion and increased basal MUC5B production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,902 S318R probably damaging Het
Abce1 A T 8: 79,703,069 N74K probably damaging Het
Akr1b7 T A 6: 34,415,469 D72E probably benign Het
Amer3 T A 1: 34,586,728 I16N possibly damaging Het
Atp6v0d1 T C 8: 105,530,974 N108D probably damaging Het
Avpr1b T C 1: 131,600,270 V177A probably damaging Het
B020011L13Rik A T 1: 117,801,239 K159* probably null Het
Brca1 G A 11: 101,523,378 T1310I probably benign Het
C130074G19Rik C A 1: 184,882,969 R8L probably damaging Het
Ccdc178 T C 18: 22,109,754 H268R possibly damaging Het
Cdc42ep5 A G 7: 4,151,474 V105A possibly damaging Het
Cntn4 T C 6: 106,506,219 L245P probably damaging Het
Crtac1 T C 19: 42,287,926 E521G probably benign Het
Cts7 T A 13: 61,355,580 N190I probably damaging Het
Cul7 A G 17: 46,662,067 E1368G probably benign Het
Dpp10 G A 1: 123,334,377 P759S probably damaging Het
Etf1 A G 18: 34,931,911 S11P unknown Het
Exd2 G T 12: 80,480,535 L167F probably damaging Het
Exoc8 T A 8: 124,896,417 R404* probably null Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fgfr2 T C 7: 130,242,406 Het
Gm4756 A T 12: 72,619,492 M89K possibly damaging Het
Gtf3c1 T A 7: 125,669,094 Het
Id2 T A 12: 25,095,821 I64F probably damaging Het
Idh3a G T 9: 54,592,472 A75S probably damaging Het
Itgb8 C G 12: 119,168,050 G620A probably damaging Het
Itih5 T A 2: 10,187,062 probably null Het
Lamtor5 A T 3: 107,282,020 D124V probably damaging Het
Mast4 T C 13: 102,794,003 E439G probably damaging Het
Meltf T G 16: 31,894,862 L641R probably damaging Het
Mesd G T 7: 83,892,212 probably benign Het
Nfia C T 4: 98,065,342 P439L probably damaging Het
Nptx1 A T 11: 119,544,590 probably null Het
Olfr1086 A G 2: 86,677,289 F15L probably benign Het
Olfr531 T A 7: 140,400,148 R299S probably benign Het
Olfr847 G A 9: 19,375,465 Q139* probably null Het
Olfr98 A T 17: 37,263,014 C217S probably benign Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pik3r5 C A 11: 68,492,943 S529R probably benign Het
Plxna2 T C 1: 194,644,282 S175P possibly damaging Het
Pom121l12 T A 11: 14,599,551 W86R probably benign Het
Ppid C T 3: 79,591,433 probably benign Het
Pramel7 T A 2: 87,492,165 D85V probably damaging Het
Prune2 C T 19: 17,121,368 T1412I probably damaging Het
Ptprd T C 4: 76,128,676 Y204C probably damaging Het
Rasgrp1 G A 2: 117,338,354 R48* probably null Het
Rbks A G 5: 31,647,783 S246P possibly damaging Het
Rnf113a2 G T 12: 84,417,677 M114I possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,922 probably benign Het
Scara3 A G 14: 65,931,644 S175P probably damaging Het
Slc4a4 T A 5: 89,122,403 L261Q probably damaging Het
Sparcl1 T C 5: 104,085,157 I593V probably benign Het
Suclg1 C T 6: 73,276,713 H115Y unknown Het
Syde2 T A 3: 145,988,755 C253S probably benign Het
Tecrl A T 5: 83,279,335 I322N probably damaging Het
Tesmin C T 19: 3,406,965 A428V probably damaging Het
Thbd T A 2: 148,406,485 T488S probably benign Het
Tln2 A T 9: 67,262,979 V876E probably damaging Het
Ttc30a2 A G 2: 75,977,679 L163P probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc13b T A 4: 43,172,910 I1246K unknown Het
Usp47 T A 7: 112,115,909 Het
Vmn1r192 C T 13: 22,187,774 R92Q probably damaging Het
Vmn2r111 T C 17: 22,548,714 T601A probably damaging Het
Vmn2r51 A G 7: 10,102,501 F118L probably benign Het
Vmn2r74 T A 7: 85,955,965 I492L probably benign Het
Vmn2r93 C T 17: 18,325,750 T628I possibly damaging Het
Vps13d C T 4: 145,156,050 R991K Het
Wdr5b T C 16: 36,041,936 S142P probably damaging Het
Zfp428 G T 7: 24,515,644 probably null Het
Other mutations in Bpifb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Bpifb1 APN 2 154217167 splice site probably benign
IGL01516:Bpifb1 APN 2 154218252 missense probably benign 0.03
IGL02047:Bpifb1 APN 2 154202616 start codon destroyed probably null 1.00
IGL02143:Bpifb1 APN 2 154209929 missense probably benign 0.14
IGL03174:Bpifb1 APN 2 154213049 missense probably damaging 1.00
IGL03263:Bpifb1 APN 2 154215306 missense probably benign 0.03
Ectoplasm UTSW 2 154211581 nonsense probably null
R0058:Bpifb1 UTSW 2 154206540 missense possibly damaging 0.54
R0269:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0617:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0786:Bpifb1 UTSW 2 154202661 missense probably benign 0.11
R1718:Bpifb1 UTSW 2 154213983 splice site probably null
R3605:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3607:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3689:Bpifb1 UTSW 2 154209899 missense probably benign 0.42
R3807:Bpifb1 UTSW 2 154214002 missense probably benign 0.25
R3930:Bpifb1 UTSW 2 154215322 missense possibly damaging 0.89
R4024:Bpifb1 UTSW 2 154213046 missense probably damaging 1.00
R4745:Bpifb1 UTSW 2 154211581 nonsense probably null
R4752:Bpifb1 UTSW 2 154216280 intron probably benign
R5505:Bpifb1 UTSW 2 154204779 missense probably benign 0.00
R5724:Bpifb1 UTSW 2 154204792 missense probably benign
R6281:Bpifb1 UTSW 2 154206465 missense probably damaging 1.00
R7038:Bpifb1 UTSW 2 154202669 missense probably damaging 0.99
R7540:Bpifb1 UTSW 2 154213111 missense probably damaging 1.00
R7599:Bpifb1 UTSW 2 154214151 missense probably damaging 1.00
R7678:Bpifb1 UTSW 2 154202729 missense possibly damaging 0.74
R7811:Bpifb1 UTSW 2 154206564 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGACAGAGCAGCGTCTCATC -3'
(R):5'- TTGAAGGAATTACTCAGTCCCGG -3'

Sequencing Primer
(F):5'- TTTCCCAGTACAGAAAATGCTGC -3'
(R):5'- GGAAGGATCCCACCCAAGG -3'
Posted On2019-06-26