Incidental Mutation 'R0579:Abcg3'
ID 56353
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 038769-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0579 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105121969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 136 (V136A)
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably damaging
Transcript: ENSMUST00000031239
AA Change: V136A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: V136A

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130644
AA Change: V136A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: V136A

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197004
Meta Mutation Damage Score 0.5346 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,839,412 (GRCm39) probably null Het
Abcf3 G A 16: 20,369,398 (GRCm39) R260Q probably benign Het
Acr C G 15: 89,453,678 (GRCm39) H72Q probably damaging Het
Ambra1 A G 2: 91,654,810 (GRCm39) N783S possibly damaging Het
Cd300ld2 A G 11: 114,903,125 (GRCm39) F240S probably benign Het
Cep83 A G 10: 94,584,915 (GRCm39) D340G possibly damaging Het
Crybg2 T A 4: 133,800,049 (GRCm39) I403N probably damaging Het
Dnah14 T A 1: 181,572,312 (GRCm39) M2881K possibly damaging Het
Erbb4 T C 1: 68,081,621 (GRCm39) M1138V probably benign Het
Evi5 A G 5: 107,969,575 (GRCm39) V112A probably benign Het
F2r A G 13: 95,754,857 (GRCm39) V9A probably benign Het
Flot1 C A 17: 36,141,900 (GRCm39) S337R probably benign Het
Glt28d2 G A 3: 85,779,440 (GRCm39) T11I probably damaging Het
Gm19345 A G 7: 19,588,901 (GRCm39) probably benign Het
Gm6605 C A 7: 38,147,699 (GRCm39) noncoding transcript Het
Hmgcs2 A T 3: 98,198,264 (GRCm39) I56F probably damaging Het
Ifna9 T A 4: 88,510,508 (GRCm39) T39S possibly damaging Het
Il21 T G 3: 37,281,923 (GRCm39) K74Q possibly damaging Het
Itpripl1 G T 2: 126,983,011 (GRCm39) Y370* probably null Het
Kif24 G A 4: 41,393,706 (GRCm39) P1056S probably damaging Het
L2hgdh A T 12: 69,748,046 (GRCm39) probably benign Het
Lipo2 A T 19: 33,724,298 (GRCm39) L156Q probably damaging Het
Nlrp4c T A 7: 6,063,844 (GRCm39) M84K probably benign Het
Npy4r G A 14: 33,868,640 (GRCm39) T216I probably benign Het
Or12d17 T C 17: 37,777,238 (GRCm39) V47A probably benign Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or6c1 A T 10: 129,518,106 (GRCm39) C167* probably null Het
Pafah1b2 T C 9: 45,880,011 (GRCm39) E222G probably benign Het
Pop1 T A 15: 34,510,115 (GRCm39) D406E possibly damaging Het
Proser1 A G 3: 53,374,572 (GRCm39) Y32C probably damaging Het
Ptprj C A 2: 90,266,913 (GRCm39) probably null Het
Slc1a3 T A 15: 8,717,793 (GRCm39) I100F probably damaging Het
Slc25a22 T C 7: 141,011,272 (GRCm39) D176G probably damaging Het
Stard7 T C 2: 127,126,473 (GRCm39) V99A probably damaging Het
Stk33 C T 7: 108,924,904 (GRCm39) V184I probably damaging Het
Timmdc1 A G 16: 38,342,745 (GRCm39) L51P probably benign Het
Tppp T C 13: 74,169,352 (GRCm39) S31P probably benign Het
Upf2 A T 2: 5,993,240 (GRCm39) R599W unknown Het
Vav1 G T 17: 57,586,271 (GRCm39) W25L probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGCTCAACCATTATTAAGATGGC -3'
(R):5'- GGGAACATTTGGATCAGGCTCTGTG -3'

Sequencing Primer
(F):5'- GTACCCAGTCACTTAGTCATTAACAG -3'
(R):5'- GTTTGGGATTAGTGAAATTGACAGC -3'
Posted On 2013-07-11