Incidental Mutation 'R7246:Olfr847'
ID563550
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Nameolfactory receptor 847
SynonymsMOR149-2, GA_x6K02T2PVTD-13113073-13112135
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R7246 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location19373668-19378669 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 19375465 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 139 (Q139*)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
Predicted Effect probably null
Transcript: ENSMUST00000079620
AA Change: Q139*
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: Q139*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216839
AA Change: Q139*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,902 S318R probably damaging Het
Abce1 A T 8: 79,703,069 N74K probably damaging Het
Akr1b7 T A 6: 34,415,469 D72E probably benign Het
Amer3 T A 1: 34,586,728 I16N possibly damaging Het
Atp6v0d1 T C 8: 105,530,974 N108D probably damaging Het
Avpr1b T C 1: 131,600,270 V177A probably damaging Het
B020011L13Rik A T 1: 117,801,239 K159* probably null Het
Bpifb1 T C 2: 154,207,092 L172P probably damaging Het
Brca1 G A 11: 101,523,378 T1310I probably benign Het
C130074G19Rik C A 1: 184,882,969 R8L probably damaging Het
Ccdc178 T C 18: 22,109,754 H268R possibly damaging Het
Cdc42ep5 A G 7: 4,151,474 V105A possibly damaging Het
Cntn4 T C 6: 106,506,219 L245P probably damaging Het
Crtac1 T C 19: 42,287,926 E521G probably benign Het
Cts7 T A 13: 61,355,580 N190I probably damaging Het
Cul7 A G 17: 46,662,067 E1368G probably benign Het
Dpp10 G A 1: 123,334,377 P759S probably damaging Het
Etf1 A G 18: 34,931,911 S11P unknown Het
Exd2 G T 12: 80,480,535 L167F probably damaging Het
Exoc8 T A 8: 124,896,417 R404* probably null Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fgfr2 T C 7: 130,242,406 Het
Gm4756 A T 12: 72,619,492 M89K possibly damaging Het
Gtf3c1 T A 7: 125,669,094 Het
Id2 T A 12: 25,095,821 I64F probably damaging Het
Idh3a G T 9: 54,592,472 A75S probably damaging Het
Itgb8 C G 12: 119,168,050 G620A probably damaging Het
Itih5 T A 2: 10,187,062 probably null Het
Lamtor5 A T 3: 107,282,020 D124V probably damaging Het
Mast4 T C 13: 102,794,003 E439G probably damaging Het
Meltf T G 16: 31,894,862 L641R probably damaging Het
Mesd G T 7: 83,892,212 probably benign Het
Nfia C T 4: 98,065,342 P439L probably damaging Het
Nptx1 A T 11: 119,544,590 probably null Het
Olfr1086 A G 2: 86,677,289 F15L probably benign Het
Olfr531 T A 7: 140,400,148 R299S probably benign Het
Olfr98 A T 17: 37,263,014 C217S probably benign Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pik3r5 C A 11: 68,492,943 S529R probably benign Het
Plxna2 T C 1: 194,644,282 S175P possibly damaging Het
Pom121l12 T A 11: 14,599,551 W86R probably benign Het
Ppid C T 3: 79,591,433 probably benign Het
Pramel7 T A 2: 87,492,165 D85V probably damaging Het
Prune2 C T 19: 17,121,368 T1412I probably damaging Het
Ptprd T C 4: 76,128,676 Y204C probably damaging Het
Rasgrp1 G A 2: 117,338,354 R48* probably null Het
Rbks A G 5: 31,647,783 S246P possibly damaging Het
Rnf113a2 G T 12: 84,417,677 M114I possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,922 probably benign Het
Scara3 A G 14: 65,931,644 S175P probably damaging Het
Slc4a4 T A 5: 89,122,403 L261Q probably damaging Het
Sparcl1 T C 5: 104,085,157 I593V probably benign Het
Suclg1 C T 6: 73,276,713 H115Y unknown Het
Syde2 T A 3: 145,988,755 C253S probably benign Het
Tecrl A T 5: 83,279,335 I322N probably damaging Het
Tesmin C T 19: 3,406,965 A428V probably damaging Het
Thbd T A 2: 148,406,485 T488S probably benign Het
Tln2 A T 9: 67,262,979 V876E probably damaging Het
Ttc30a2 A G 2: 75,977,679 L163P probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc13b T A 4: 43,172,910 I1246K unknown Het
Usp47 T A 7: 112,115,909 Het
Vmn1r192 C T 13: 22,187,774 R92Q probably damaging Het
Vmn2r111 T C 17: 22,548,714 T601A probably damaging Het
Vmn2r51 A G 7: 10,102,501 F118L probably benign Het
Vmn2r74 T A 7: 85,955,965 I492L probably benign Het
Vmn2r93 C T 17: 18,325,750 T628I possibly damaging Het
Vps13d C T 4: 145,156,050 R991K Het
Wdr5b T C 16: 36,041,936 S142P probably damaging Het
Zfp428 G T 7: 24,515,644 probably null Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7886:Olfr847 UTSW 9 19375906 splice site probably null
R7969:Olfr847 UTSW 9 19375906 splice site probably null
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTTTGTATCTTCCTCTCAGG -3'
(R):5'- CCACTGTCCCAAACATGTTGAAG -3'

Sequencing Primer
(F):5'- TTCCTCTCAGGGAAGAGATTTTC -3'
(R):5'- TGTTGAAGAACATCCACACACAGG -3'
Posted On2019-06-26