Incidental Mutation 'R7246:Brca1'
ID563557
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7246 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101523378 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1310 (T1310I)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: T1310I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: T1310I

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,902 S318R probably damaging Het
Abce1 A T 8: 79,703,069 N74K probably damaging Het
Akr1b7 T A 6: 34,415,469 D72E probably benign Het
Amer3 T A 1: 34,586,728 I16N possibly damaging Het
Atp6v0d1 T C 8: 105,530,974 N108D probably damaging Het
Avpr1b T C 1: 131,600,270 V177A probably damaging Het
B020011L13Rik A T 1: 117,801,239 K159* probably null Het
Bpifb1 T C 2: 154,207,092 L172P probably damaging Het
C130074G19Rik C A 1: 184,882,969 R8L probably damaging Het
Ccdc178 T C 18: 22,109,754 H268R possibly damaging Het
Cdc42ep5 A G 7: 4,151,474 V105A possibly damaging Het
Cntn4 T C 6: 106,506,219 L245P probably damaging Het
Crtac1 T C 19: 42,287,926 E521G probably benign Het
Cts7 T A 13: 61,355,580 N190I probably damaging Het
Cul7 A G 17: 46,662,067 E1368G probably benign Het
Dpp10 G A 1: 123,334,377 P759S probably damaging Het
Etf1 A G 18: 34,931,911 S11P unknown Het
Exd2 G T 12: 80,480,535 L167F probably damaging Het
Exoc8 T A 8: 124,896,417 R404* probably null Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fgfr2 T C 7: 130,242,406 Het
Gm4756 A T 12: 72,619,492 M89K possibly damaging Het
Gtf3c1 T A 7: 125,669,094 Het
Id2 T A 12: 25,095,821 I64F probably damaging Het
Idh3a G T 9: 54,592,472 A75S probably damaging Het
Itgb8 C G 12: 119,168,050 G620A probably damaging Het
Itih5 T A 2: 10,187,062 probably null Het
Lamtor5 A T 3: 107,282,020 D124V probably damaging Het
Mast4 T C 13: 102,794,003 E439G probably damaging Het
Meltf T G 16: 31,894,862 L641R probably damaging Het
Mesd G T 7: 83,892,212 probably benign Het
Nfia C T 4: 98,065,342 P439L probably damaging Het
Nptx1 A T 11: 119,544,590 probably null Het
Olfr1086 A G 2: 86,677,289 F15L probably benign Het
Olfr531 T A 7: 140,400,148 R299S probably benign Het
Olfr847 G A 9: 19,375,465 Q139* probably null Het
Olfr98 A T 17: 37,263,014 C217S probably benign Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pik3r5 C A 11: 68,492,943 S529R probably benign Het
Plxna2 T C 1: 194,644,282 S175P possibly damaging Het
Pom121l12 T A 11: 14,599,551 W86R probably benign Het
Ppid C T 3: 79,591,433 probably benign Het
Pramel7 T A 2: 87,492,165 D85V probably damaging Het
Prune2 C T 19: 17,121,368 T1412I probably damaging Het
Ptprd T C 4: 76,128,676 Y204C probably damaging Het
Rasgrp1 G A 2: 117,338,354 R48* probably null Het
Rbks A G 5: 31,647,783 S246P possibly damaging Het
Rnf113a2 G T 12: 84,417,677 M114I possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,922 probably benign Het
Scara3 A G 14: 65,931,644 S175P probably damaging Het
Slc4a4 T A 5: 89,122,403 L261Q probably damaging Het
Sparcl1 T C 5: 104,085,157 I593V probably benign Het
Suclg1 C T 6: 73,276,713 H115Y unknown Het
Syde2 T A 3: 145,988,755 C253S probably benign Het
Tecrl A T 5: 83,279,335 I322N probably damaging Het
Tesmin C T 19: 3,406,965 A428V probably damaging Het
Thbd T A 2: 148,406,485 T488S probably benign Het
Tln2 A T 9: 67,262,979 V876E probably damaging Het
Ttc30a2 A G 2: 75,977,679 L163P probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc13b T A 4: 43,172,910 I1246K unknown Het
Usp47 T A 7: 112,115,909 Het
Vmn1r192 C T 13: 22,187,774 R92Q probably damaging Het
Vmn2r111 T C 17: 22,548,714 T601A probably damaging Het
Vmn2r51 A G 7: 10,102,501 F118L probably benign Het
Vmn2r74 T A 7: 85,955,965 I492L probably benign Het
Vmn2r93 C T 17: 18,325,750 T628I possibly damaging Het
Vps13d C T 4: 145,156,050 R991K Het
Wdr5b T C 16: 36,041,936 S142P probably damaging Het
Zfp428 G T 7: 24,515,644 probably null Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTGTGTGGGCTACTTATACAC -3'
(R):5'- GCAGCATGTTCTCTTCACAG -3'

Sequencing Primer
(F):5'- TCCCCTGGAATTGAAGTGAC -3'
(R):5'- AGCATGTTCTCTTCACAGCACAG -3'
Posted On2019-06-26