Incidental Mutation 'R7246:Itgb8'
ID563563
Institutional Source Beutler Lab
Gene Symbol Itgb8
Ensembl Gene ENSMUSG00000025321
Gene Nameintegrin beta 8
Synonyms4832412O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7246 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location119158022-119238802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 119168050 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 620 (G620A)
Ref Sequence ENSEMBL: ENSMUSP00000026360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026360]
Predicted Effect probably damaging
Transcript: ENSMUST00000026360
AA Change: G620A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026360
Gene: ENSMUSG00000025321
AA Change: G620A

DomainStartEndE-ValueType
Blast:INB 1 44 9e-8 BLAST
PSI 46 95 6.65e-9 SMART
INB 54 469 4.31e-237 SMART
VWA 146 352 2.15e-1 SMART
Blast:INB 494 532 9e-12 BLAST
EGF 551 583 1.53e1 SMART
transmembrane domain 680 702 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene either die before E11.5 as a result of circulatory abnormalities in the placenta or die within the first for days after birth and display intracerebral hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,902 S318R probably damaging Het
Abce1 A T 8: 79,703,069 N74K probably damaging Het
Akr1b7 T A 6: 34,415,469 D72E probably benign Het
Amer3 T A 1: 34,586,728 I16N possibly damaging Het
Atp6v0d1 T C 8: 105,530,974 N108D probably damaging Het
Avpr1b T C 1: 131,600,270 V177A probably damaging Het
B020011L13Rik A T 1: 117,801,239 K159* probably null Het
Bpifb1 T C 2: 154,207,092 L172P probably damaging Het
Brca1 G A 11: 101,523,378 T1310I probably benign Het
C130074G19Rik C A 1: 184,882,969 R8L probably damaging Het
Ccdc178 T C 18: 22,109,754 H268R possibly damaging Het
Cdc42ep5 A G 7: 4,151,474 V105A possibly damaging Het
Cntn4 T C 6: 106,506,219 L245P probably damaging Het
Crtac1 T C 19: 42,287,926 E521G probably benign Het
Cts7 T A 13: 61,355,580 N190I probably damaging Het
Cul7 A G 17: 46,662,067 E1368G probably benign Het
Dpp10 G A 1: 123,334,377 P759S probably damaging Het
Etf1 A G 18: 34,931,911 S11P unknown Het
Exd2 G T 12: 80,480,535 L167F probably damaging Het
Exoc8 T A 8: 124,896,417 R404* probably null Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fgfr2 T C 7: 130,242,406 Het
Gm4756 A T 12: 72,619,492 M89K possibly damaging Het
Gtf3c1 T A 7: 125,669,094 Het
Id2 T A 12: 25,095,821 I64F probably damaging Het
Idh3a G T 9: 54,592,472 A75S probably damaging Het
Itih5 T A 2: 10,187,062 probably null Het
Lamtor5 A T 3: 107,282,020 D124V probably damaging Het
Mast4 T C 13: 102,794,003 E439G probably damaging Het
Meltf T G 16: 31,894,862 L641R probably damaging Het
Mesd G T 7: 83,892,212 probably benign Het
Nfia C T 4: 98,065,342 P439L probably damaging Het
Nptx1 A T 11: 119,544,590 probably null Het
Olfr1086 A G 2: 86,677,289 F15L probably benign Het
Olfr531 T A 7: 140,400,148 R299S probably benign Het
Olfr847 G A 9: 19,375,465 Q139* probably null Het
Olfr98 A T 17: 37,263,014 C217S probably benign Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pik3r5 C A 11: 68,492,943 S529R probably benign Het
Plxna2 T C 1: 194,644,282 S175P possibly damaging Het
Pom121l12 T A 11: 14,599,551 W86R probably benign Het
Ppid C T 3: 79,591,433 probably benign Het
Pramel7 T A 2: 87,492,165 D85V probably damaging Het
Prune2 C T 19: 17,121,368 T1412I probably damaging Het
Ptprd T C 4: 76,128,676 Y204C probably damaging Het
Rasgrp1 G A 2: 117,338,354 R48* probably null Het
Rbks A G 5: 31,647,783 S246P possibly damaging Het
Rnf113a2 G T 12: 84,417,677 M114I possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,922 probably benign Het
Scara3 A G 14: 65,931,644 S175P probably damaging Het
Slc4a4 T A 5: 89,122,403 L261Q probably damaging Het
Sparcl1 T C 5: 104,085,157 I593V probably benign Het
Suclg1 C T 6: 73,276,713 H115Y unknown Het
Syde2 T A 3: 145,988,755 C253S probably benign Het
Tecrl A T 5: 83,279,335 I322N probably damaging Het
Tesmin C T 19: 3,406,965 A428V probably damaging Het
Thbd T A 2: 148,406,485 T488S probably benign Het
Tln2 A T 9: 67,262,979 V876E probably damaging Het
Ttc30a2 A G 2: 75,977,679 L163P probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc13b T A 4: 43,172,910 I1246K unknown Het
Usp47 T A 7: 112,115,909 Het
Vmn1r192 C T 13: 22,187,774 R92Q probably damaging Het
Vmn2r111 T C 17: 22,548,714 T601A probably damaging Het
Vmn2r51 A G 7: 10,102,501 F118L probably benign Het
Vmn2r74 T A 7: 85,955,965 I492L probably benign Het
Vmn2r93 C T 17: 18,325,750 T628I possibly damaging Het
Vps13d C T 4: 145,156,050 R991K Het
Wdr5b T C 16: 36,041,936 S142P probably damaging Het
Zfp428 G T 7: 24,515,644 probably null Het
Other mutations in Itgb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Itgb8 APN 12 119189826 missense probably damaging 0.99
IGL01859:Itgb8 APN 12 119189945 missense probably damaging 1.00
IGL02555:Itgb8 APN 12 119189881 missense probably damaging 1.00
IGL02665:Itgb8 APN 12 119166865 splice site probably benign
IGL02732:Itgb8 APN 12 119163353 missense probably benign 0.09
R0090:Itgb8 UTSW 12 119202563 missense probably benign 0.00
R0245:Itgb8 UTSW 12 119190555 missense probably damaging 1.00
R0629:Itgb8 UTSW 12 119202481 missense probably benign 0.38
R1158:Itgb8 UTSW 12 119202496 missense probably damaging 1.00
R1355:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1370:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1604:Itgb8 UTSW 12 119202530 missense probably damaging 1.00
R1689:Itgb8 UTSW 12 119170820 missense probably benign 0.38
R1782:Itgb8 UTSW 12 119192118 missense probably damaging 0.99
R1789:Itgb8 UTSW 12 119202455 missense probably benign
R2113:Itgb8 UTSW 12 119190612 missense probably damaging 1.00
R2301:Itgb8 UTSW 12 119202455 missense probably benign
R3696:Itgb8 UTSW 12 119177011 missense probably damaging 0.99
R3797:Itgb8 UTSW 12 119163469 missense possibly damaging 0.92
R3911:Itgb8 UTSW 12 119168005 missense possibly damaging 0.65
R4904:Itgb8 UTSW 12 119170871 missense probably benign 0.00
R5391:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5395:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5444:Itgb8 UTSW 12 119237838 utr 5 prime probably benign
R5461:Itgb8 UTSW 12 119168005 missense probably benign 0.28
R5610:Itgb8 UTSW 12 119170694 missense probably damaging 1.00
R5669:Itgb8 UTSW 12 119190628 missense probably damaging 1.00
R5877:Itgb8 UTSW 12 119202536 missense probably benign 0.37
R6581:Itgb8 UTSW 12 119163215 missense probably benign 0.41
R6597:Itgb8 UTSW 12 119173398 missense possibly damaging 0.94
R6631:Itgb8 UTSW 12 119180977 nonsense probably null
R6971:Itgb8 UTSW 12 119190631 missense probably damaging 1.00
R7124:Itgb8 UTSW 12 119202424 nonsense probably null
R7282:Itgb8 UTSW 12 119237708 missense probably benign 0.00
R7299:Itgb8 UTSW 12 119202461 missense probably benign 0.00
R7340:Itgb8 UTSW 12 119192204 missense probably benign 0.45
R7373:Itgb8 UTSW 12 119202475 missense probably benign 0.01
R7766:Itgb8 UTSW 12 119163359 missense probably damaging 1.00
R7855:Itgb8 UTSW 12 119166772 missense probably benign
R8195:Itgb8 UTSW 12 119168170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAAAGTTTCCCACTCAGGATTG -3'
(R):5'- CCAAGTGTGTCTCTGTTGCAGG -3'

Sequencing Primer
(F):5'- GAAGAGCAAAACCAGCTGT -3'
(R):5'- TCTCTGTTGCAGGGCATG -3'
Posted On2019-06-26