Incidental Mutation 'R0579:Stk33'
ID56357
Institutional Source Beutler Lab
Gene Symbol Stk33
Ensembl Gene ENSMUSG00000031027
Gene Nameserine/threonine kinase 33
Synonyms
MMRRC Submission 038769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0579 (G1)
Quality Score105
Status Validated
Chromosome7
Chromosomal Location109279223-109439081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109325697 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 184 (V184I)
Ref Sequence ENSEMBL: ENSMUSP00000112560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090414] [ENSMUST00000106745] [ENSMUST00000121378] [ENSMUST00000121748] [ENSMUST00000141210]
Predicted Effect probably damaging
Transcript: ENSMUST00000090414
AA Change: V307I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087897
Gene: ENSMUSG00000031027
AA Change: V307I

DomainStartEndE-ValueType
S_TKc 111 377 4.7e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106745
AA Change: V307I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102356
Gene: ENSMUSG00000031027
AA Change: V307I

DomainStartEndE-ValueType
S_TKc 111 377 4.7e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121378
AA Change: V184I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112560
Gene: ENSMUSG00000031027
AA Change: V184I

DomainStartEndE-ValueType
S_TKc 2 254 1.01e-83 SMART
low complexity region 276 291 N/A INTRINSIC
low complexity region 322 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121748
AA Change: V307I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112515
Gene: ENSMUSG00000031027
AA Change: V307I

DomainStartEndE-ValueType
S_TKc 111 377 4.8e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141210
Meta Mutation Damage Score 0.3325 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Abcf3 G A 16: 20,550,648 R260Q probably benign Het
Abcg3 A G 5: 104,974,103 V136A probably damaging Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Ambra1 A G 2: 91,824,465 N783S possibly damaging Het
Cd300ld2 A G 11: 115,012,299 F240S probably benign Het
Cep83 A G 10: 94,749,053 D340G possibly damaging Het
Crybg2 T A 4: 134,072,738 I403N probably damaging Het
Dnah14 T A 1: 181,744,747 M2881K possibly damaging Het
Erbb4 T C 1: 68,042,462 M1138V probably benign Het
Evi5 A G 5: 107,821,709 V112A probably benign Het
F2r A G 13: 95,618,349 V9A probably benign Het
Flot1 C A 17: 35,831,008 S337R probably benign Het
Glt28d2 G A 3: 85,872,133 T11I probably damaging Het
Gm19345 A G 7: 19,854,976 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Hmgcs2 A T 3: 98,290,948 I56F probably damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Il21 T G 3: 37,227,774 K74Q possibly damaging Het
Itpripl1 G T 2: 127,141,091 Y370* probably null Het
Kif24 G A 4: 41,393,706 P1056S probably damaging Het
L2hgdh A T 12: 69,701,272 probably benign Het
Lipo2 A T 19: 33,746,898 L156Q probably damaging Het
Nlrp4c T A 7: 6,060,845 M84K probably benign Het
Npy4r G A 14: 34,146,683 T216I probably benign Het
Olfr109 T C 17: 37,466,347 V47A probably benign Het
Olfr802 A T 10: 129,682,237 C167* probably null Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pafah1b2 T C 9: 45,968,713 E222G probably benign Het
Pop1 T A 15: 34,509,969 D406E possibly damaging Het
Proser1 A G 3: 53,467,151 Y32C probably damaging Het
Ptprj C A 2: 90,436,569 probably null Het
Slc1a3 T A 15: 8,688,309 I100F probably damaging Het
Slc25a22 T C 7: 141,431,359 D176G probably damaging Het
Stard7 T C 2: 127,284,553 V99A probably damaging Het
Timmdc1 A G 16: 38,522,383 L51P probably benign Het
Tppp T C 13: 74,021,233 S31P probably benign Het
Upf2 A T 2: 5,988,429 R599W unknown Het
Vav1 G T 17: 57,279,271 W25L probably benign Het
Other mutations in Stk33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Stk33 APN 7 109329568 missense probably benign 0.02
IGL01467:Stk33 APN 7 109329589 missense probably damaging 0.99
IGL01558:Stk33 APN 7 109341284 intron probably benign
IGL01775:Stk33 APN 7 109312367 missense possibly damaging 0.92
R0052:Stk33 UTSW 7 109279669 missense possibly damaging 0.46
R0336:Stk33 UTSW 7 109331474 missense probably benign 0.01
R0394:Stk33 UTSW 7 109341489 missense probably benign
R0727:Stk33 UTSW 7 109321518 missense probably damaging 0.96
R1363:Stk33 UTSW 7 109279821 missense probably benign 0.06
R1574:Stk33 UTSW 7 109279820 missense probably benign 0.01
R1574:Stk33 UTSW 7 109279820 missense probably benign 0.01
R2153:Stk33 UTSW 7 109341320 missense probably benign 0.01
R4366:Stk33 UTSW 7 109279795 missense probably benign 0.06
R4896:Stk33 UTSW 7 109327595 missense probably damaging 1.00
R4994:Stk33 UTSW 7 109340398 missense probably benign 0.08
R5283:Stk33 UTSW 7 109336127 missense possibly damaging 0.69
R6339:Stk33 UTSW 7 109321465 missense probably benign 0.03
R6547:Stk33 UTSW 7 109320835 missense possibly damaging 0.73
R6717:Stk33 UTSW 7 109327616 missense possibly damaging 0.51
R6894:Stk33 UTSW 7 109336062 missense possibly damaging 0.70
Z1176:Stk33 UTSW 7 109336059 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCTTAGCGCAAAGCAAAACTGAACG -3'
(R):5'- ATTCGGCATCTGCTGTTGGCTC -3'

Sequencing Primer
(F):5'- AATACTTAGGAGGTGATTCTGAGGC -3'
(R):5'- TTCTTGTTCGCTCCAGAGG -3'
Posted On2013-07-11