Incidental Mutation 'R7246:Vmn2r111'
ID 563572
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7246 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 22547941-22573273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22548714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 601 (T601A)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect probably damaging
Transcript: ENSMUST00000092491
AA Change: T601A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: T601A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,902 S318R probably damaging Het
Abce1 A T 8: 79,703,069 N74K probably damaging Het
Akr1b7 T A 6: 34,415,469 D72E probably benign Het
Amer3 T A 1: 34,586,728 I16N possibly damaging Het
Atp6v0d1 T C 8: 105,530,974 N108D probably damaging Het
Avpr1b T C 1: 131,600,270 V177A probably damaging Het
B020011L13Rik A T 1: 117,801,239 K159* probably null Het
Bpifb1 T C 2: 154,207,092 L172P probably damaging Het
Brca1 G A 11: 101,523,378 T1310I probably benign Het
C130074G19Rik C A 1: 184,882,969 R8L probably damaging Het
Ccdc178 T C 18: 22,109,754 H268R possibly damaging Het
Cdc42ep5 A G 7: 4,151,474 V105A possibly damaging Het
Cntn4 T C 6: 106,506,219 L245P probably damaging Het
Crtac1 T C 19: 42,287,926 E521G probably benign Het
Cts7 T A 13: 61,355,580 N190I probably damaging Het
Cul7 A G 17: 46,662,067 E1368G probably benign Het
Dpp10 G A 1: 123,334,377 P759S probably damaging Het
Etf1 A G 18: 34,931,911 S11P unknown Het
Exd2 G T 12: 80,480,535 L167F probably damaging Het
Exoc8 T A 8: 124,896,417 R404* probably null Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fgfr2 T C 7: 130,242,406 Het
Gm4756 A T 12: 72,619,492 M89K possibly damaging Het
Gtf3c1 T A 7: 125,669,094 Het
Id2 T A 12: 25,095,821 I64F probably damaging Het
Idh3a G T 9: 54,592,472 A75S probably damaging Het
Itgb8 C G 12: 119,168,050 G620A probably damaging Het
Itih5 T A 2: 10,187,062 probably null Het
Lamtor5 A T 3: 107,282,020 D124V probably damaging Het
Mast4 T C 13: 102,794,003 E439G probably damaging Het
Meltf T G 16: 31,894,862 L641R probably damaging Het
Mesd G T 7: 83,892,212 probably benign Het
Nfia C T 4: 98,065,342 P439L probably damaging Het
Nptx1 A T 11: 119,544,590 probably null Het
Olfr1086 A G 2: 86,677,289 F15L probably benign Het
Olfr531 T A 7: 140,400,148 R299S probably benign Het
Olfr847 G A 9: 19,375,465 Q139* probably null Het
Olfr98 A T 17: 37,263,014 C217S probably benign Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pik3r5 C A 11: 68,492,943 S529R probably benign Het
Plxna2 T C 1: 194,644,282 S175P possibly damaging Het
Pom121l12 T A 11: 14,599,551 W86R probably benign Het
Ppid C T 3: 79,591,433 probably benign Het
Pramel7 T A 2: 87,492,165 D85V probably damaging Het
Prune2 C T 19: 17,121,368 T1412I probably damaging Het
Ptprd T C 4: 76,128,676 Y204C probably damaging Het
Rasgrp1 G A 2: 117,338,354 R48* probably null Het
Rbks A G 5: 31,647,783 S246P possibly damaging Het
Rnf113a2 G T 12: 84,417,677 M114I possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,922 probably benign Het
Scara3 A G 14: 65,931,644 S175P probably damaging Het
Slc4a4 T A 5: 89,122,403 L261Q probably damaging Het
Sparcl1 T C 5: 104,085,157 I593V probably benign Het
Suclg1 C T 6: 73,276,713 H115Y unknown Het
Syde2 T A 3: 145,988,755 C253S probably benign Het
Tecrl A T 5: 83,279,335 I322N probably damaging Het
Tesmin C T 19: 3,406,965 A428V probably damaging Het
Thbd T A 2: 148,406,485 T488S probably benign Het
Tln2 A T 9: 67,262,979 V876E probably damaging Het
Ttc30a2 A G 2: 75,977,679 L163P probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc13b T A 4: 43,172,910 I1246K unknown Het
Usp47 T A 7: 112,115,909 Het
Vmn1r192 C T 13: 22,187,774 R92Q probably damaging Het
Vmn2r51 A G 7: 10,102,501 F118L probably benign Het
Vmn2r74 T A 7: 85,955,965 I492L probably benign Het
Vmn2r93 C T 17: 18,325,750 T628I possibly damaging Het
Vps13d C T 4: 145,156,050 R991K Het
Wdr5b T C 16: 36,041,936 S142P probably damaging Het
Zfp428 G T 7: 24,515,644 probably null Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22548030 missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22571841 missense probably benign
R9374:Vmn2r111 UTSW 17 22568878 missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22559151 missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAACAGTGAATACAACTCCAAATGTG -3'
(R):5'- ATTGCAGCACTTCTTGTATATGCTG -3'

Sequencing Primer
(F):5'- CCAAATGTGATTTGTTGTAGAATGC -3'
(R):5'- CAGCACTTCTTGTATATGCTGAAATG -3'
Posted On 2019-06-26