Incidental Mutation 'R7247:Nvl'
ID 563585
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 045310-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R7247 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 180939851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000027797
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,240,732 (GRCm39) E865G probably benign Het
Actrt2 A C 4: 154,751,880 (GRCm39) D85E probably benign Het
Ankrd55 A G 13: 112,472,787 (GRCm39) E153G probably damaging Het
Arfgef3 T A 10: 18,501,139 (GRCm39) H1037L probably benign Het
Camk2a A G 18: 61,076,277 (GRCm39) Y85C unknown Het
Caprin1 A T 2: 103,609,819 (GRCm39) V153E possibly damaging Het
Caskin2 G A 11: 115,692,722 (GRCm39) P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Ccdc116 T C 16: 16,957,555 (GRCm39) T535A possibly damaging Het
Cdh9 G A 15: 16,778,341 (GRCm39) R52H probably damaging Het
Cdk5rap2 A G 4: 70,255,666 (GRCm39) L406S probably damaging Het
Cep350 A G 1: 155,786,499 (GRCm39) M1449T probably damaging Het
Chst8 T A 7: 34,375,361 (GRCm39) K159N probably damaging Het
Dcdc2a A G 13: 25,286,374 (GRCm39) H136R probably benign Het
Dip2a C T 10: 76,108,366 (GRCm39) probably null Het
Dock2 G A 11: 34,605,340 (GRCm39) R260* probably null Het
Dscam A G 16: 96,622,008 (GRCm39) V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 (GRCm39) D112G probably damaging Het
Ezh2 T C 6: 47,510,708 (GRCm39) K634E probably damaging Het
Fcgr2b A G 1: 170,793,269 (GRCm39) probably null Het
Fgfrl1 T C 5: 108,851,365 (GRCm39) V94A possibly damaging Het
Gpr156 C A 16: 37,768,103 (GRCm39) N6K probably damaging Het
Gsdmc2 A T 15: 63,705,183 (GRCm39) F177I probably benign Het
Igkv4-54 T A 6: 69,608,842 (GRCm39) S26C probably damaging Het
Iglc3 T C 16: 18,884,191 (GRCm39) H80R Het
Immp1l G A 2: 105,767,401 (GRCm39) G87S probably damaging Het
Itgav A T 2: 83,555,179 (GRCm39) D34V probably damaging Het
Lrp1b G A 2: 41,159,224 (GRCm39) T1686I Het
Ltn1 T C 16: 87,206,275 (GRCm39) D935G probably benign Het
Map3k8 T C 18: 4,334,036 (GRCm39) D352G probably damaging Het
Map3k9 T C 12: 81,772,604 (GRCm39) K610E possibly damaging Het
Marchf4 G T 1: 72,491,637 (GRCm39) Y211* probably null Het
Marf1 A T 16: 13,944,957 (GRCm39) L1304Q probably damaging Het
Matcap1 A T 8: 106,011,331 (GRCm39) Y268N probably benign Het
Mecom A G 3: 30,194,505 (GRCm39) V5A unknown Het
Mep1a A T 17: 43,785,995 (GRCm39) V711D possibly damaging Het
Naca T A 10: 127,878,467 (GRCm39) D1166E unknown Het
Neb G T 2: 52,148,753 (GRCm39) P2598Q probably damaging Het
Notch4 A T 17: 34,791,491 (GRCm39) E546V probably damaging Het
Nudt18 A G 14: 70,815,422 (GRCm39) T12A unknown Het
Obscn G T 11: 58,994,144 (GRCm39) C1579* probably null Het
Or4b13 G A 2: 90,083,165 (GRCm39) P56S probably damaging Het
Or51e2 T C 7: 102,391,551 (GRCm39) I220V probably damaging Het
Or6c5b T C 10: 129,246,051 (GRCm39) V272A probably damaging Het
Or7g33 A T 9: 19,448,629 (GRCm39) I199K probably benign Het
Or8g19 T A 9: 39,056,153 (GRCm39) Y252* probably null Het
Oxa1l A T 14: 54,598,312 (GRCm39) M1L probably benign Het
Paqr9 A G 9: 95,442,246 (GRCm39) T79A possibly damaging Het
Plec A T 15: 76,061,543 (GRCm39) V2798E probably damaging Het
Potefam3f A G 8: 20,479,022 (GRCm39) N10S Het
Ptpn4 A T 1: 119,617,764 (GRCm39) *557R probably null Het
Ptprt T C 2: 161,375,443 (GRCm39) E1379G probably benign Het
Rad18 G T 6: 112,642,286 (GRCm39) T327K possibly damaging Het
Rps2 T A 17: 24,939,554 (GRCm39) I75N possibly damaging Het
Scgb2b2 A T 7: 31,003,021 (GRCm39) R39W probably damaging Het
Sh3d21 A G 4: 126,045,908 (GRCm39) F307S probably benign Het
Snap91 A G 9: 86,674,669 (GRCm39) V507A unknown Het
Srgap1 T A 10: 121,705,695 (GRCm39) Y243F probably damaging Het
Stim1 T A 7: 102,070,739 (GRCm39) probably null Het
Top2b T C 14: 16,416,962 (GRCm38) V1161A probably benign Het
Tpcn1 T C 5: 120,723,315 (GRCm39) D16G possibly damaging Het
Trank1 A T 9: 111,196,580 (GRCm39) I1535F probably damaging Het
Txnrd2 T C 16: 18,274,822 (GRCm39) F278L probably damaging Het
Ufl1 A T 4: 25,254,637 (GRCm39) D579E probably damaging Het
Vps45 T C 3: 95,948,717 (GRCm39) N346S probably benign Het
Vps51 T A 19: 6,127,419 (GRCm39) probably benign Het
Zfp536 T C 7: 37,268,631 (GRCm39) N262D probably benign Het
Zmynd10 A G 9: 107,425,976 (GRCm39) I103M possibly damaging Het
Zswim1 C T 2: 164,667,719 (GRCm39) H324Y possibly damaging Het
Zxdc T C 6: 90,361,155 (GRCm39) W507R unknown Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTCCCAGGAATGAGGGTGAC -3'
(R):5'- AGAGAGCCTTTCCTGTTTATCAC -3'

Sequencing Primer
(F):5'- TGAGGGTGACACAACCAATTAAAAC -3'
(R):5'- GACCAGTCACCATCATTTTTAGG -3'
Posted On 2019-06-26