Incidental Mutation 'R7247:Rad18'
ID563607
Institutional Source Beutler Lab
Gene Symbol Rad18
Ensembl Gene ENSMUSG00000030254
Gene NameRAD18 E3 ubiquitin protein ligase
Synonyms2810024C04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001167730, NM_021385; MGI: 1890476

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7247 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location112619850-112696686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112665325 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 327 (T327K)
Ref Sequence ENSEMBL: ENSMUSP00000070619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068487] [ENSMUST00000077088] [ENSMUST00000113180] [ENSMUST00000113182] [ENSMUST00000142079] [ENSMUST00000156063]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068487
AA Change: T327K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070619
Gene: ENSMUSG00000030254
AA Change: T327K

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
internal_repeat_1 398 422 2.94e-14 PROSPERO
internal_repeat_1 422 446 2.94e-14 PROSPERO
low complexity region 473 488 N/A INTRINSIC
low complexity region 495 507 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077088
AA Change: T327K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076341
Gene: ENSMUSG00000030254
AA Change: T327K

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
PDB:2YBF|B 340 363 7e-6 PDB
internal_repeat_1 372 396 1.24e-14 PROSPERO
internal_repeat_1 396 420 1.24e-14 PROSPERO
low complexity region 447 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113180
AA Change: T327K

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108805
Gene: ENSMUSG00000030254
AA Change: T327K

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113182
AA Change: T327K

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108807
Gene: ENSMUSG00000030254
AA Change: T327K

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
low complexity region 388 400 N/A INTRINSIC
low complexity region 407 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142079
AA Change: T41K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117582
Gene: ENSMUSG00000030254
AA Change: T41K

DomainStartEndE-ValueType
internal_repeat_1 112 136 3.29e-13 PROSPERO
internal_repeat_1 136 160 3.29e-13 PROSPERO
low complexity region 187 202 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156063
AA Change: Y301*
SMART Domains Protein: ENSMUSP00000138558
Gene: ENSMUSG00000030254
AA Change: Y301*

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a null allele exhibit age-dependent decrease in fertility, germ cell number, and testes weight with progressive degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI

 All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,284,699 Y268N probably benign Het
Abca13 A G 11: 9,290,732 E865G probably benign Het
Actrt2 A C 4: 154,667,423 D85E probably benign Het
Ankrd55 A G 13: 112,336,253 E153G probably damaging Het
Arfgef3 T A 10: 18,625,391 H1037L probably benign Het
Camk2a A G 18: 60,943,205 Y85C unknown Het
Caprin1 A T 2: 103,779,474 V153E possibly damaging Het
Caskin2 G A 11: 115,801,896 P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc116 T C 16: 17,139,691 T535A possibly damaging Het
Cdh9 G A 15: 16,778,255 R52H probably damaging Het
Cdk5rap2 A G 4: 70,337,429 L406S probably damaging Het
Cep350 A G 1: 155,910,753 M1449T probably damaging Het
Chst8 T A 7: 34,675,936 K159N probably damaging Het
Dcdc2a A G 13: 25,102,391 H136R probably benign Het
Dip2a C T 10: 76,272,532 probably null Het
Dock2 G A 11: 34,714,513 R260* probably null Het
Dscam A G 16: 96,820,808 V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 D112G probably damaging Het
Ezh2 T C 6: 47,533,774 K634E probably damaging Het
Fcgr2b A G 1: 170,965,700 probably null Het
Fgfrl1 T C 5: 108,703,499 V94A possibly damaging Het
Gm31371 A G 8: 19,903,421 N10S Het
Gpr156 C A 16: 37,947,741 N6K probably damaging Het
Gsdmc2 A T 15: 63,833,334 F177I probably benign Het
Igkv4-54 T A 6: 69,631,858 S26C probably damaging Het
Iglc3 T C 16: 19,065,441 H80R Het
Immp1l G A 2: 105,937,056 G87S probably damaging Het
Itgav A T 2: 83,724,835 D34V probably damaging Het
Lrp1b G A 2: 41,269,212 T1686I Het
Ltn1 T C 16: 87,409,387 D935G probably benign Het
Map3k8 T C 18: 4,334,036 D352G probably damaging Het
Map3k9 T C 12: 81,725,830 K610E possibly damaging Het
March4 G T 1: 72,452,478 Y211* probably null Het
Marf1 A T 16: 14,127,093 L1304Q probably damaging Het
Mecom A G 3: 30,140,356 V5A unknown Het
Mep1a A T 17: 43,475,104 V711D possibly damaging Het
Naca T A 10: 128,042,598 D1166E unknown Het
Neb G T 2: 52,258,741 P2598Q probably damaging Het
Notch4 A T 17: 34,572,517 E546V probably damaging Het
Nudt18 A G 14: 70,577,982 T12A unknown Het
Nvl A C 1: 181,112,286 probably null Het
Obscn G T 11: 59,103,318 C1579* probably null Het
Olfr142 G A 2: 90,252,821 P56S probably damaging Het
Olfr27 T A 9: 39,144,857 Y252* probably null Het
Olfr78 T C 7: 102,742,344 I220V probably damaging Het
Olfr785 T C 10: 129,410,182 V272A probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Paqr9 A G 9: 95,560,193 T79A possibly damaging Het
Plec A T 15: 76,177,343 V2798E probably damaging Het
Ptpn4 A T 1: 119,690,034 *557R probably null Het
Ptprt T C 2: 161,533,523 E1379G probably benign Het
Rps2 T A 17: 24,720,580 I75N possibly damaging Het
Scgb2b2 A T 7: 31,303,596 R39W probably damaging Het
Sh3d21 A G 4: 126,152,115 F307S probably benign Het
Snap91 A G 9: 86,792,616 V507A unknown Het
Srgap1 T A 10: 121,869,790 Y243F probably damaging Het
Stim1 T A 7: 102,421,532 probably null Het
Top2b T C 14: 16,416,962 V1161A probably benign Het
Tpcn1 T C 5: 120,585,250 D16G possibly damaging Het
Trank1 A T 9: 111,367,512 I1535F probably damaging Het
Txnrd2 T C 16: 18,456,072 F278L probably damaging Het
Ufl1 A T 4: 25,254,637 D579E probably damaging Het
Vps45 T C 3: 96,041,405 N346S probably benign Het
Vps51 T A 19: 6,077,389 probably benign Het
Zfp536 T C 7: 37,569,206 N262D probably benign Het
Zmynd10 A G 9: 107,548,777 I103M possibly damaging Het
Zswim1 C T 2: 164,825,799 H324Y possibly damaging Het
Zxdc T C 6: 90,384,173 W507R unknown Het
Other mutations in Rad18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01577:Rad18 APN 6 112665341 splice site probably benign
IGL02425:Rad18 APN 6 112620898 missense probably damaging 1.00
IGL02622:Rad18 APN 6 112687987 missense probably damaging 0.99
IGL02814:Rad18 APN 6 112644622 missense possibly damaging 0.72
3-1:Rad18 UTSW 6 112681511 nonsense probably null
R0823:Rad18 UTSW 6 112665299 missense possibly damaging 0.80
R1220:Rad18 UTSW 6 112649664 nonsense probably null
R1351:Rad18 UTSW 6 112620902 missense possibly damaging 0.55
R1378:Rad18 UTSW 6 112681336 splice site probably benign
R1623:Rad18 UTSW 6 112628519 missense probably damaging 1.00
R1737:Rad18 UTSW 6 112681537 missense probably damaging 1.00
R2509:Rad18 UTSW 6 112675922 missense possibly damaging 0.93
R2893:Rad18 UTSW 6 112675773 nonsense probably null
R2894:Rad18 UTSW 6 112675773 nonsense probably null
R3017:Rad18 UTSW 6 112681366 missense possibly damaging 0.95
R3123:Rad18 UTSW 6 112681346 missense probably benign 0.41
R3755:Rad18 UTSW 6 112693471 missense probably damaging 1.00
R4392:Rad18 UTSW 6 112693529 missense probably damaging 1.00
R5285:Rad18 UTSW 6 112686765 missense probably benign 0.45
R5566:Rad18 UTSW 6 112681346 missense probably benign 0.41
R5958:Rad18 UTSW 6 112696642 unclassified probably benign
R6744:Rad18 UTSW 6 112675784 missense probably damaging 1.00
R7072:Rad18 UTSW 6 112681440 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGCTGAACGTTAGTCACAGATC -3'
(R):5'- ATCATACGGTCTGAGGCAGG -3'

Sequencing Primer
(F):5'- CGTTAGTCACAGATCTTAAAAGGCAG -3'
(R):5'- GGGACAAACATGCGGGTTACAC -3'
Posted On2019-06-26