Incidental Mutation 'R7247:Zfp536'
ID563610
Institutional Source Beutler Lab
Gene Symbol Zfp536
Ensembl Gene ENSMUSG00000043456
Gene Namezinc finger protein 536
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7247 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location37472135-37773641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37569206 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 262 (N262D)
Ref Sequence ENSEMBL: ENSMUSP00000058468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056338] [ENSMUST00000175941] [ENSMUST00000176114] [ENSMUST00000176205] [ENSMUST00000176534] [ENSMUST00000176680]
Predicted Effect probably benign
Transcript: ENSMUST00000056338
AA Change: N262D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058468
Gene: ENSMUSG00000043456
AA Change: N262D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
Pfam:zf-C2H2_assoc 657 739 6.6e-43 PFAM
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175941
AA Change: N262D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134778
Gene: ENSMUSG00000043456
AA Change: N262D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176114
AA Change: N262D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135681
Gene: ENSMUSG00000043456
AA Change: N262D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176205
AA Change: N262D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135068
Gene: ENSMUSG00000043456
AA Change: N262D

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176534
Predicted Effect probably benign
Transcript: ENSMUST00000176680
SMART Domains Protein: ENSMUSP00000135218
Gene: ENSMUSG00000043456

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a highly conserved zinc finger protein. The encoded protein is most abundant in brain, where it negatively regulates neuronal differentiation. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,284,699 Y268N probably benign Het
Abca13 A G 11: 9,290,732 E865G probably benign Het
Actrt2 A C 4: 154,667,423 D85E probably benign Het
Ankrd55 A G 13: 112,336,253 E153G probably damaging Het
Arfgef3 T A 10: 18,625,391 H1037L probably benign Het
Camk2a A G 18: 60,943,205 Y85C unknown Het
Caprin1 A T 2: 103,779,474 V153E possibly damaging Het
Caskin2 G A 11: 115,801,896 P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc116 T C 16: 17,139,691 T535A possibly damaging Het
Cdh9 G A 15: 16,778,255 R52H probably damaging Het
Cdk5rap2 A G 4: 70,337,429 L406S probably damaging Het
Cep350 A G 1: 155,910,753 M1449T probably damaging Het
Chst8 T A 7: 34,675,936 K159N probably damaging Het
Dcdc2a A G 13: 25,102,391 H136R probably benign Het
Dip2a C T 10: 76,272,532 probably null Het
Dock2 G A 11: 34,714,513 R260* probably null Het
Dscam A G 16: 96,820,808 V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 D112G probably damaging Het
Ezh2 T C 6: 47,533,774 K634E probably damaging Het
Fcgr2b A G 1: 170,965,700 probably null Het
Fgfrl1 T C 5: 108,703,499 V94A possibly damaging Het
Gm31371 A G 8: 19,903,421 N10S Het
Gpr156 C A 16: 37,947,741 N6K probably damaging Het
Gsdmc2 A T 15: 63,833,334 F177I probably benign Het
Igkv4-54 T A 6: 69,631,858 S26C probably damaging Het
Iglc3 T C 16: 19,065,441 H80R Het
Immp1l G A 2: 105,937,056 G87S probably damaging Het
Itgav A T 2: 83,724,835 D34V probably damaging Het
Lrp1b G A 2: 41,269,212 T1686I Het
Ltn1 T C 16: 87,409,387 D935G probably benign Het
Map3k8 T C 18: 4,334,036 D352G probably damaging Het
Map3k9 T C 12: 81,725,830 K610E possibly damaging Het
March4 G T 1: 72,452,478 Y211* probably null Het
Marf1 A T 16: 14,127,093 L1304Q probably damaging Het
Mecom A G 3: 30,140,356 V5A unknown Het
Mep1a A T 17: 43,475,104 V711D possibly damaging Het
Naca T A 10: 128,042,598 D1166E unknown Het
Neb G T 2: 52,258,741 P2598Q probably damaging Het
Notch4 A T 17: 34,572,517 E546V probably damaging Het
Nudt18 A G 14: 70,577,982 T12A unknown Het
Nvl A C 1: 181,112,286 probably null Het
Obscn G T 11: 59,103,318 C1579* probably null Het
Olfr142 G A 2: 90,252,821 P56S probably damaging Het
Olfr27 T A 9: 39,144,857 Y252* probably null Het
Olfr78 T C 7: 102,742,344 I220V probably damaging Het
Olfr785 T C 10: 129,410,182 V272A probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Paqr9 A G 9: 95,560,193 T79A possibly damaging Het
Plec A T 15: 76,177,343 V2798E probably damaging Het
Ptpn4 A T 1: 119,690,034 *557R probably null Het
Ptprt T C 2: 161,533,523 E1379G probably benign Het
Rad18 G T 6: 112,665,325 T327K possibly damaging Het
Rps2 T A 17: 24,720,580 I75N possibly damaging Het
Scgb2b2 A T 7: 31,303,596 R39W probably damaging Het
Sh3d21 A G 4: 126,152,115 F307S probably benign Het
Snap91 A G 9: 86,792,616 V507A unknown Het
Srgap1 T A 10: 121,869,790 Y243F probably damaging Het
Stim1 T A 7: 102,421,532 probably null Het
Top2b T C 14: 16,416,962 V1161A probably benign Het
Tpcn1 T C 5: 120,585,250 D16G possibly damaging Het
Trank1 A T 9: 111,367,512 I1535F probably damaging Het
Txnrd2 T C 16: 18,456,072 F278L probably damaging Het
Ufl1 A T 4: 25,254,637 D579E probably damaging Het
Vps45 T C 3: 96,041,405 N346S probably benign Het
Vps51 T A 19: 6,077,389 probably benign Het
Zmynd10 A G 9: 107,548,777 I103M possibly damaging Het
Zswim1 C T 2: 164,825,799 H324Y possibly damaging Het
Zxdc T C 6: 90,384,173 W507R unknown Het
Other mutations in Zfp536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Zfp536 APN 7 37567890 missense probably damaging 0.99
IGL02729:Zfp536 APN 7 37493718 missense probably damaging 1.00
PIT4453001:Zfp536 UTSW 7 37479757 missense probably benign 0.08
R0211:Zfp536 UTSW 7 37568449 missense probably damaging 1.00
R0369:Zfp536 UTSW 7 37567948 missense probably damaging 1.00
R0504:Zfp536 UTSW 7 37568818 missense probably damaging 1.00
R0554:Zfp536 UTSW 7 37480819 missense probably damaging 1.00
R1171:Zfp536 UTSW 7 37569634 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1699:Zfp536 UTSW 7 37569454 missense probably damaging 1.00
R1817:Zfp536 UTSW 7 37568617 missense probably damaging 1.00
R1918:Zfp536 UTSW 7 37480199 missense probably damaging 1.00
R2252:Zfp536 UTSW 7 37479389 missense probably benign 0.30
R2288:Zfp536 UTSW 7 37480348 missense probably damaging 0.98
R2509:Zfp536 UTSW 7 37567978 missense possibly damaging 0.87
R3967:Zfp536 UTSW 7 37473830 makesense probably null
R4039:Zfp536 UTSW 7 37569550 missense probably damaging 1.00
R4600:Zfp536 UTSW 7 37568493 missense probably damaging 1.00
R4706:Zfp536 UTSW 7 37569466 missense probably damaging 1.00
R4771:Zfp536 UTSW 7 37568884 missense probably damaging 1.00
R4808:Zfp536 UTSW 7 37479305 missense probably damaging 1.00
R4945:Zfp536 UTSW 7 37569736 missense probably damaging 1.00
R5196:Zfp536 UTSW 7 37480760 missense probably damaging 1.00
R5506:Zfp536 UTSW 7 37568792 missense probably damaging 1.00
R5816:Zfp536 UTSW 7 37480628 missense probably damaging 1.00
R6114:Zfp536 UTSW 7 37479736 missense probably damaging 0.99
R6131:Zfp536 UTSW 7 37569712 missense probably damaging 1.00
R6156:Zfp536 UTSW 7 37473856 missense unknown
R6257:Zfp536 UTSW 7 37480405 missense probably damaging 1.00
R6864:Zfp536 UTSW 7 37568515 missense probably damaging 1.00
R6975:Zfp536 UTSW 7 37568527 missense probably damaging 1.00
R6976:Zfp536 UTSW 7 37480403 missense probably damaging 1.00
R7176:Zfp536 UTSW 7 37480851 critical splice acceptor site probably null
R7325:Zfp536 UTSW 7 37479860 missense probably benign
R7650:Zfp536 UTSW 7 37569692 missense probably damaging 1.00
R7782:Zfp536 UTSW 7 37568701 missense probably damaging 1.00
R7827:Zfp536 UTSW 7 37569688 missense probably damaging 1.00
X0066:Zfp536 UTSW 7 37569781 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTGATATGGGCCTTCTCCAC -3'
(R):5'- TACGTGAGGAGAACCGTCTG -3'

Sequencing Primer
(F):5'- TCCACGTGACTGATGAGCTC -3'
(R):5'- AGAACCGTCTGCTGCAC -3'
Posted On2019-06-26