Incidental Mutation 'R7247:Olfr27'
ID563616
Institutional Source Beutler Lab
Gene Symbol Olfr27
Ensembl Gene ENSMUSG00000049708
Gene Nameolfactory receptor 27
SynonymsMOR171-6, GA_x6K02T2PVTD-32841223-32842158, MTPCR56
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7247 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39128131-39145072 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 39144857 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 252 (Y252*)
Ref Sequence ENSEMBL: ENSMUSP00000151012 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000214052
AA Change: Y252*
Predicted Effect probably null
Transcript: ENSMUST00000216405
AA Change: Y252*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,284,699 Y268N probably benign Het
Abca13 A G 11: 9,290,732 E865G probably benign Het
Actrt2 A C 4: 154,667,423 D85E probably benign Het
Ankrd55 A G 13: 112,336,253 E153G probably damaging Het
Arfgef3 T A 10: 18,625,391 H1037L probably benign Het
Camk2a A G 18: 60,943,205 Y85C unknown Het
Caprin1 A T 2: 103,779,474 V153E possibly damaging Het
Caskin2 G A 11: 115,801,896 P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc116 T C 16: 17,139,691 T535A possibly damaging Het
Cdh9 G A 15: 16,778,255 R52H probably damaging Het
Cdk5rap2 A G 4: 70,337,429 L406S probably damaging Het
Cep350 A G 1: 155,910,753 M1449T probably damaging Het
Chst8 T A 7: 34,675,936 K159N probably damaging Het
Dcdc2a A G 13: 25,102,391 H136R probably benign Het
Dip2a C T 10: 76,272,532 probably null Het
Dock2 G A 11: 34,714,513 R260* probably null Het
Dscam A G 16: 96,820,808 V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 D112G probably damaging Het
Ezh2 T C 6: 47,533,774 K634E probably damaging Het
Fcgr2b A G 1: 170,965,700 probably null Het
Fgfrl1 T C 5: 108,703,499 V94A possibly damaging Het
Gm31371 A G 8: 19,903,421 N10S Het
Gpr156 C A 16: 37,947,741 N6K probably damaging Het
Gsdmc2 A T 15: 63,833,334 F177I probably benign Het
Igkv4-54 T A 6: 69,631,858 S26C probably damaging Het
Iglc3 T C 16: 19,065,441 H80R Het
Immp1l G A 2: 105,937,056 G87S probably damaging Het
Itgav A T 2: 83,724,835 D34V probably damaging Het
Lrp1b G A 2: 41,269,212 T1686I Het
Ltn1 T C 16: 87,409,387 D935G probably benign Het
Map3k8 T C 18: 4,334,036 D352G probably damaging Het
Map3k9 T C 12: 81,725,830 K610E possibly damaging Het
March4 G T 1: 72,452,478 Y211* probably null Het
Marf1 A T 16: 14,127,093 L1304Q probably damaging Het
Mecom A G 3: 30,140,356 V5A unknown Het
Mep1a A T 17: 43,475,104 V711D possibly damaging Het
Naca T A 10: 128,042,598 D1166E unknown Het
Neb G T 2: 52,258,741 P2598Q probably damaging Het
Notch4 A T 17: 34,572,517 E546V probably damaging Het
Nudt18 A G 14: 70,577,982 T12A unknown Het
Nvl A C 1: 181,112,286 probably null Het
Obscn G T 11: 59,103,318 C1579* probably null Het
Olfr142 G A 2: 90,252,821 P56S probably damaging Het
Olfr78 T C 7: 102,742,344 I220V probably damaging Het
Olfr785 T C 10: 129,410,182 V272A probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Paqr9 A G 9: 95,560,193 T79A possibly damaging Het
Plec A T 15: 76,177,343 V2798E probably damaging Het
Ptpn4 A T 1: 119,690,034 *557R probably null Het
Ptprt T C 2: 161,533,523 E1379G probably benign Het
Rad18 G T 6: 112,665,325 T327K possibly damaging Het
Rps2 T A 17: 24,720,580 I75N possibly damaging Het
Scgb2b2 A T 7: 31,303,596 R39W probably damaging Het
Sh3d21 A G 4: 126,152,115 F307S probably benign Het
Snap91 A G 9: 86,792,616 V507A unknown Het
Srgap1 T A 10: 121,869,790 Y243F probably damaging Het
Stim1 T A 7: 102,421,532 probably null Het
Top2b T C 14: 16,416,962 V1161A probably benign Het
Tpcn1 T C 5: 120,585,250 D16G possibly damaging Het
Trank1 A T 9: 111,367,512 I1535F probably damaging Het
Txnrd2 T C 16: 18,456,072 F278L probably damaging Het
Ufl1 A T 4: 25,254,637 D579E probably damaging Het
Vps45 T C 3: 96,041,405 N346S probably benign Het
Vps51 T A 19: 6,077,389 probably benign Het
Zfp536 T C 7: 37,569,206 N262D probably benign Het
Zmynd10 A G 9: 107,548,777 I103M possibly damaging Het
Zswim1 C T 2: 164,825,799 H324Y possibly damaging Het
Zxdc T C 6: 90,384,173 W507R unknown Het
Other mutations in Olfr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr27 APN 9 39144757 missense possibly damaging 0.94
IGL00905:Olfr27 APN 9 39145030 missense probably damaging 1.00
IGL02346:Olfr27 APN 9 39144643 missense probably damaging 1.00
R0117:Olfr27 UTSW 9 39144850 missense probably damaging 1.00
R0118:Olfr27 UTSW 9 39144103 start codon destroyed probably null 0.97
R0590:Olfr27 UTSW 9 39144721 missense probably benign 0.01
R2915:Olfr27 UTSW 9 39144466 missense possibly damaging 0.94
R4299:Olfr27 UTSW 9 39144999 missense probably benign 0.11
R4367:Olfr27 UTSW 9 39144429 missense probably damaging 0.98
R4663:Olfr27 UTSW 9 39144849 missense probably damaging 0.97
R5276:Olfr27 UTSW 9 39144315 missense probably damaging 1.00
R5503:Olfr27 UTSW 9 39144484 missense probably benign 0.02
R5742:Olfr27 UTSW 9 39144678 missense probably benign 0.07
R5986:Olfr27 UTSW 9 39144982 missense probably null 1.00
R6801:Olfr27 UTSW 9 39144210 missense probably benign 0.01
R7520:Olfr27 UTSW 9 39144118 missense probably benign
R7787:Olfr27 UTSW 9 39144252 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGACTCAGTTCTGCAATTTAGATGTG -3'
(R):5'- TGTTCACATGATTCCTGCTTACATG -3'

Sequencing Primer
(F):5'- CTTGAATCTTGCATCCTCTAATACG -3'
(R):5'- GCATGGGTACAACAGTAG -3'
Posted On2019-06-26