Incidental Mutation 'R7247:Trank1'
ID563620
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7247 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111367512 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1535 (I1535F)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: I1535F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: I1535F

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,284,699 Y268N probably benign Het
Abca13 A G 11: 9,290,732 E865G probably benign Het
Actrt2 A C 4: 154,667,423 D85E probably benign Het
Ankrd55 A G 13: 112,336,253 E153G probably damaging Het
Arfgef3 T A 10: 18,625,391 H1037L probably benign Het
Camk2a A G 18: 60,943,205 Y85C unknown Het
Caprin1 A T 2: 103,779,474 V153E possibly damaging Het
Caskin2 G A 11: 115,801,896 P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc116 T C 16: 17,139,691 T535A possibly damaging Het
Cdh9 G A 15: 16,778,255 R52H probably damaging Het
Cdk5rap2 A G 4: 70,337,429 L406S probably damaging Het
Cep350 A G 1: 155,910,753 M1449T probably damaging Het
Chst8 T A 7: 34,675,936 K159N probably damaging Het
Dcdc2a A G 13: 25,102,391 H136R probably benign Het
Dip2a C T 10: 76,272,532 probably null Het
Dock2 G A 11: 34,714,513 R260* probably null Het
Dscam A G 16: 96,820,808 V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 D112G probably damaging Het
Ezh2 T C 6: 47,533,774 K634E probably damaging Het
Fcgr2b A G 1: 170,965,700 probably null Het
Fgfrl1 T C 5: 108,703,499 V94A possibly damaging Het
Gm31371 A G 8: 19,903,421 N10S Het
Gpr156 C A 16: 37,947,741 N6K probably damaging Het
Gsdmc2 A T 15: 63,833,334 F177I probably benign Het
Igkv4-54 T A 6: 69,631,858 S26C probably damaging Het
Iglc3 T C 16: 19,065,441 H80R Het
Immp1l G A 2: 105,937,056 G87S probably damaging Het
Itgav A T 2: 83,724,835 D34V probably damaging Het
Lrp1b G A 2: 41,269,212 T1686I Het
Ltn1 T C 16: 87,409,387 D935G probably benign Het
Map3k8 T C 18: 4,334,036 D352G probably damaging Het
Map3k9 T C 12: 81,725,830 K610E possibly damaging Het
March4 G T 1: 72,452,478 Y211* probably null Het
Marf1 A T 16: 14,127,093 L1304Q probably damaging Het
Mecom A G 3: 30,140,356 V5A unknown Het
Mep1a A T 17: 43,475,104 V711D possibly damaging Het
Naca T A 10: 128,042,598 D1166E unknown Het
Neb G T 2: 52,258,741 P2598Q probably damaging Het
Notch4 A T 17: 34,572,517 E546V probably damaging Het
Nudt18 A G 14: 70,577,982 T12A unknown Het
Nvl A C 1: 181,112,286 probably null Het
Obscn G T 11: 59,103,318 C1579* probably null Het
Olfr142 G A 2: 90,252,821 P56S probably damaging Het
Olfr27 T A 9: 39,144,857 Y252* probably null Het
Olfr78 T C 7: 102,742,344 I220V probably damaging Het
Olfr785 T C 10: 129,410,182 V272A probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Paqr9 A G 9: 95,560,193 T79A possibly damaging Het
Plec A T 15: 76,177,343 V2798E probably damaging Het
Ptpn4 A T 1: 119,690,034 *557R probably null Het
Ptprt T C 2: 161,533,523 E1379G probably benign Het
Rad18 G T 6: 112,665,325 T327K possibly damaging Het
Rps2 T A 17: 24,720,580 I75N possibly damaging Het
Scgb2b2 A T 7: 31,303,596 R39W probably damaging Het
Sh3d21 A G 4: 126,152,115 F307S probably benign Het
Snap91 A G 9: 86,792,616 V507A unknown Het
Srgap1 T A 10: 121,869,790 Y243F probably damaging Het
Stim1 T A 7: 102,421,532 probably null Het
Top2b T C 14: 16,416,962 V1161A probably benign Het
Tpcn1 T C 5: 120,585,250 D16G possibly damaging Het
Txnrd2 T C 16: 18,456,072 F278L probably damaging Het
Ufl1 A T 4: 25,254,637 D579E probably damaging Het
Vps45 T C 3: 96,041,405 N346S probably benign Het
Vps51 T A 19: 6,077,389 probably benign Het
Zfp536 T C 7: 37,569,206 N262D probably benign Het
Zmynd10 A G 9: 107,548,777 I103M possibly damaging Het
Zswim1 C T 2: 164,825,799 H324Y possibly damaging Het
Zxdc T C 6: 90,384,173 W507R unknown Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7912:Trank1 UTSW 9 111391528 missense probably benign 0.04
R7938:Trank1 UTSW 9 111365028 missense probably benign
R7979:Trank1 UTSW 9 111377899 missense probably benign 0.00
R8064:Trank1 UTSW 9 111352076 nonsense probably null
R8100:Trank1 UTSW 9 111392793 missense probably damaging 1.00
R8124:Trank1 UTSW 9 111378927 missense probably benign 0.31
R8198:Trank1 UTSW 9 111390812 missense probably benign 0.09
R8219:Trank1 UTSW 9 111364909 missense probably damaging 1.00
R8223:Trank1 UTSW 9 111365889 missense probably damaging 1.00
R8316:Trank1 UTSW 9 111349302 missense probably benign 0.38
R8347:Trank1 UTSW 9 111367249 missense probably damaging 1.00
R8436:Trank1 UTSW 9 111391382 missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111390275 missense probably benign 0.01
R8682:Trank1 UTSW 9 111365344 missense probably benign 0.01
R8768:Trank1 UTSW 9 111389276 missense probably benign 0.00
R8770:Trank1 UTSW 9 111390824 missense probably benign 0.00
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense unknown
Z1177:Trank1 UTSW 9 111367377 missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111392870 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCCATCCATGAGCTTTATGGTG -3'
(R):5'- TCTATTTACAGATGAGTGCTGGC -3'

Sequencing Primer
(F):5'- GTGATGAGATTCAGGACTTCACCC -3'
(R):5'- GAGTGCTGGCAAAAATCCTAAGTTC -3'
Posted On2019-06-26