Incidental Mutation 'R7247:Ltn1'
ID563644
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7247 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87409387 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 935 (D935G)
Ref Sequence ENSEMBL: ENSMUSP00000038775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect probably benign
Transcript: ENSMUST00000039449
AA Change: D935G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: D935G

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232095
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,284,699 Y268N probably benign Het
Abca13 A G 11: 9,290,732 E865G probably benign Het
Actrt2 A C 4: 154,667,423 D85E probably benign Het
Ankrd55 A G 13: 112,336,253 E153G probably damaging Het
Arfgef3 T A 10: 18,625,391 H1037L probably benign Het
Camk2a A G 18: 60,943,205 Y85C unknown Het
Caprin1 A T 2: 103,779,474 V153E possibly damaging Het
Caskin2 G A 11: 115,801,896 P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc116 T C 16: 17,139,691 T535A possibly damaging Het
Cdh9 G A 15: 16,778,255 R52H probably damaging Het
Cdk5rap2 A G 4: 70,337,429 L406S probably damaging Het
Cep350 A G 1: 155,910,753 M1449T probably damaging Het
Chst8 T A 7: 34,675,936 K159N probably damaging Het
Dcdc2a A G 13: 25,102,391 H136R probably benign Het
Dip2a C T 10: 76,272,532 probably null Het
Dock2 G A 11: 34,714,513 R260* probably null Het
Dscam A G 16: 96,820,808 V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 D112G probably damaging Het
Ezh2 T C 6: 47,533,774 K634E probably damaging Het
Fcgr2b A G 1: 170,965,700 probably null Het
Fgfrl1 T C 5: 108,703,499 V94A possibly damaging Het
Gm31371 A G 8: 19,903,421 N10S Het
Gpr156 C A 16: 37,947,741 N6K probably damaging Het
Gsdmc2 A T 15: 63,833,334 F177I probably benign Het
Igkv4-54 T A 6: 69,631,858 S26C probably damaging Het
Iglc3 T C 16: 19,065,441 H80R Het
Immp1l G A 2: 105,937,056 G87S probably damaging Het
Itgav A T 2: 83,724,835 D34V probably damaging Het
Lrp1b G A 2: 41,269,212 T1686I Het
Map3k8 T C 18: 4,334,036 D352G probably damaging Het
Map3k9 T C 12: 81,725,830 K610E possibly damaging Het
March4 G T 1: 72,452,478 Y211* probably null Het
Marf1 A T 16: 14,127,093 L1304Q probably damaging Het
Mecom A G 3: 30,140,356 V5A unknown Het
Mep1a A T 17: 43,475,104 V711D possibly damaging Het
Naca T A 10: 128,042,598 D1166E unknown Het
Neb G T 2: 52,258,741 P2598Q probably damaging Het
Notch4 A T 17: 34,572,517 E546V probably damaging Het
Nudt18 A G 14: 70,577,982 T12A unknown Het
Nvl A C 1: 181,112,286 probably null Het
Obscn G T 11: 59,103,318 C1579* probably null Het
Olfr142 G A 2: 90,252,821 P56S probably damaging Het
Olfr27 T A 9: 39,144,857 Y252* probably null Het
Olfr78 T C 7: 102,742,344 I220V probably damaging Het
Olfr785 T C 10: 129,410,182 V272A probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Paqr9 A G 9: 95,560,193 T79A possibly damaging Het
Plec A T 15: 76,177,343 V2798E probably damaging Het
Ptpn4 A T 1: 119,690,034 *557R probably null Het
Ptprt T C 2: 161,533,523 E1379G probably benign Het
Rad18 G T 6: 112,665,325 T327K possibly damaging Het
Rps2 T A 17: 24,720,580 I75N possibly damaging Het
Scgb2b2 A T 7: 31,303,596 R39W probably damaging Het
Sh3d21 A G 4: 126,152,115 F307S probably benign Het
Snap91 A G 9: 86,792,616 V507A unknown Het
Srgap1 T A 10: 121,869,790 Y243F probably damaging Het
Stim1 T A 7: 102,421,532 probably null Het
Top2b T C 14: 16,416,962 V1161A probably benign Het
Tpcn1 T C 5: 120,585,250 D16G possibly damaging Het
Trank1 A T 9: 111,367,512 I1535F probably damaging Het
Txnrd2 T C 16: 18,456,072 F278L probably damaging Het
Ufl1 A T 4: 25,254,637 D579E probably damaging Het
Vps45 T C 3: 96,041,405 N346S probably benign Het
Vps51 T A 19: 6,077,389 probably benign Het
Zfp536 T C 7: 37,569,206 N262D probably benign Het
Zmynd10 A G 9: 107,548,777 I103M possibly damaging Het
Zswim1 C T 2: 164,825,799 H324Y possibly damaging Het
Zxdc T C 6: 90,384,173 W507R unknown Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7454:Ltn1 UTSW 16 87397812 missense probably benign 0.03
R7471:Ltn1 UTSW 16 87397899 missense probably benign
R7511:Ltn1 UTSW 16 87408828 missense possibly damaging 0.63
R7691:Ltn1 UTSW 16 87398686 missense probably damaging 0.99
R7702:Ltn1 UTSW 16 87426278 missense probably damaging 1.00
R7761:Ltn1 UTSW 16 87411793 missense probably benign
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAATGCAAGAAATCCTTTTCACTG -3'
(R):5'- AGTCCCAGATTTGAGGCTCTG -3'

Sequencing Primer
(F):5'- GTGGAAGACACACCTGAA -3'
(R):5'- GTAGGACGGATCACTCCTCTC -3'
Posted On2019-06-26