Mutagenetix > Incidental Mutations

Incidental Mutation 'R7248:Chd6'

563664

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.765) question?

Stock #

R7248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 160961279 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 2160 (Q2160*)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

Predicted Effect

probably null
Transcript: ENSMUST00000039782
AA Change: Q2160*

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: Q2160*

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,310		probably null	Het
2810403A07Rik	T	C	3: 88,693,579	S228P	probably damaging	Het
4931409K22Rik	C	T	5: 24,544,271	S743N	probably benign	Het
Aldh16a1	A	G	7: 45,145,594	Y484H	probably damaging	Het
Arhgap26	T	C	18: 39,306,854		probably null	Het
Atxn7l1	A	G	12: 33,367,195	T452A	probably benign	Het
Baz1a	C	T	12: 54,900,508	E1119K	probably damaging	Het
Btaf1	A	T	19: 36,945,314	E39D	possibly damaging	Het
Bud13	G	T	9: 46,283,115	E29*	probably null	Het
Cbwd1	A	G	19: 24,921,141	S318P	probably damaging	Het
Ccdc144b	T	A	3: 36,025,937	T224S	probably benign	Het
Ccdc150	C	T	1: 54,304,898	T530I	probably benign	Het
Cluap1	T	A	16: 3,919,500	I172N	possibly damaging	Het
Cnot2	T	C	10: 116,498,373	N329S	probably benign	Het
Cog4	A	T	8: 110,882,202	T175S	unknown	Het
Coq7	C	A	7: 118,529,674	R46L	probably benign	Het
D630045J12Rik	A	T	6: 38,168,263	V1276E	probably damaging	Het
Dcaf15	A	G	8: 84,102,765	V116A	possibly damaging	Het
Ddr2	C	T	1: 169,994,629	V417I	probably benign	Het
Defa25	G	A	8: 21,085,200	C65Y	probably damaging	Het
Dhx38	T	C	8: 109,558,927	T425A	probably benign	Het
Diaph1	T	C	18: 37,889,776	T782A	probably benign	Het
Dnah7b	T	A	1: 46,142,085	M1044K	possibly damaging	Het
Dusp16	G	A	6: 134,718,977	T297M	probably benign	Het
Esyt2	A	G	12: 116,342,238	N363D	probably damaging	Het
Fasl	C	T	1: 161,788,191	C32Y	possibly damaging	Het
Flg	T	C	3: 93,281,734	V137A	probably benign	Het
Gpr150	G	A	13: 76,056,007	A273V	probably benign	Het
Grk5	A	G	19: 60,890,607	T10A	probably benign	Het
Hivep2	A	G	10: 14,131,165	K1169R	possibly damaging	Het
Ido2	A	C	8: 24,540,641	Y224*	probably null	Het
Ido2	A	G	8: 24,548,823	I149T	probably damaging	Het
Kctd2	A	G	11: 115,422,019	T126A	possibly damaging	Het
Kif1a	T	C	1: 93,041,583	D1090G	probably benign	Het
Klrb1a	A	T	6: 128,609,734	H222Q	possibly damaging	Het
Kndc1	A	C	7: 139,920,783	H688P	probably damaging	Het
Lrriq1	C	A	10: 103,223,750	V141F	possibly damaging	Het
Malrd1	A	G	2: 16,101,911	I1845V	unknown	Het
Mob3c	G	A	4: 115,831,684	R138H	probably benign	Het
Mre11a	T	A	9: 14,811,913	D394E	possibly damaging	Het
Myh7b	A	T	2: 155,622,186	I536F	probably damaging	Het
Nacad	T	A	11: 6,598,589	K1382*	probably null	Het
Ncor1	T	C	11: 62,384,772	K128R	possibly damaging	Het
Olfr1349	T	C	7: 6,514,521	N303D	probably damaging	Het
Ostn	T	A	16: 27,346,969		probably null	Het
Pacs1	G	A	19: 5,138,975	T793I	probably damaging	Het
Pcdhb2	T	C	18: 37,296,494	S507P	probably damaging	Het
Pde2a	A	G	7: 101,503,390	K393E	possibly damaging	Het
Pfkl	T	A	10: 77,989,589	N656Y	probably damaging	Het
Phf20	T	A	2: 156,293,411		probably null	Het
Plekha6	G	T	1: 133,275,848	E550*	probably null	Het
Plxna4	A	T	6: 32,162,160	V1691E	probably damaging	Het
Rag1	A	T	2: 101,641,778	H1006Q	probably damaging	Het
Rfx4	C	T	10: 84,905,055	P679L	probably benign	Het
Ripor2	A	G	13: 24,694,145	H301R	probably damaging	Het
Rrp12	A	T	19: 41,883,438	I469N	possibly damaging	Het
Serpinb6b	A	G	13: 32,977,576	T211A	probably benign	Het
Sf1	A	T	19: 6,376,353	H547L	unknown	Het
Slc29a1	T	C	17: 45,592,182	D9G	probably damaging	Het
Sptan1	T	A	2: 30,002,299	M1075K	probably benign	Het
Syngap1	A	G	17: 26,957,767	D474G	probably damaging	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Timeless	A	G	10: 128,252,001	T1148A	probably benign	Het
Tmem116	A	T	5: 121,463,836		probably null	Het
Tmem158	A	T	9: 123,260,325	I74N	probably damaging	Het
Traf5	T	A	1: 192,059,017	D174V	probably benign	Het
Trim65	A	T	11: 116,127,708	I247N	probably benign	Het
Tsfm	A	T	10: 127,011,631	V197E	probably benign	Het
Utrn	A	G	10: 12,728,818	C539R	possibly damaging	Het
Vps13a	A	T	19: 16,678,042	F1874Y	probably benign	Het
Wdr6	A	G	9: 108,576,039	M215T	possibly damaging	Het
Wdr75	T	A	1: 45,817,400	W528R	probably damaging	Het
Zc3h7b	A	G	15: 81,771,787	D112G	possibly damaging	Het
Zc3hav1	C	T	6: 38,353,976	D83N	probably benign	Het
Zfp369	T	A	13: 65,296,117	V358E	probably damaging	Het
Zfp946	T	A	17: 22,453,508	C29*	probably null	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	not run
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTCCCCTGACAACCTACAG -3'
(R):5'- GGATCGTGTGATAATTAACCGCC -3'

Sequencing Primer
(F):5'- GACAACCTACAGGCTCTAGTTTAGG -3'
(R):5'- CCGCCTAGATAATATTTGCCATGTGG -3'

Posted On

2019-06-26