Incidental Mutation 'R7248:Aldh16a1'
ID563677
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Namealdehyde dehydrogenase 16 family, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7248 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45140684-45154584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45145594 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 484 (Y484H)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
Predicted Effect probably damaging
Transcript: ENSMUST00000107815
AA Change: Y484H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: Y484H

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably damaging
Transcript: ENSMUST00000209963
AA Change: Y484H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,310 probably null Het
2810403A07Rik T C 3: 88,693,579 S228P probably damaging Het
4931409K22Rik C T 5: 24,544,271 S743N probably benign Het
Arhgap26 T C 18: 39,306,854 probably null Het
Atxn7l1 A G 12: 33,367,195 T452A probably benign Het
Baz1a C T 12: 54,900,508 E1119K probably damaging Het
Btaf1 A T 19: 36,945,314 E39D possibly damaging Het
Bud13 G T 9: 46,283,115 E29* probably null Het
Cbwd1 A G 19: 24,921,141 S318P probably damaging Het
Ccdc144b T A 3: 36,025,937 T224S probably benign Het
Ccdc150 C T 1: 54,304,898 T530I probably benign Het
Chd6 G A 2: 160,961,279 Q2160* probably null Het
Cluap1 T A 16: 3,919,500 I172N possibly damaging Het
Cnot2 T C 10: 116,498,373 N329S probably benign Het
Cog4 A T 8: 110,882,202 T175S unknown Het
Coq7 C A 7: 118,529,674 R46L probably benign Het
D630045J12Rik A T 6: 38,168,263 V1276E probably damaging Het
Dcaf15 A G 8: 84,102,765 V116A possibly damaging Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Defa25 G A 8: 21,085,200 C65Y probably damaging Het
Dhx38 T C 8: 109,558,927 T425A probably benign Het
Diaph1 T C 18: 37,889,776 T782A probably benign Het
Dnah7b T A 1: 46,142,085 M1044K possibly damaging Het
Dusp16 G A 6: 134,718,977 T297M probably benign Het
Esyt2 A G 12: 116,342,238 N363D probably damaging Het
Fasl C T 1: 161,788,191 C32Y possibly damaging Het
Flg T C 3: 93,281,734 V137A probably benign Het
Gpr150 G A 13: 76,056,007 A273V probably benign Het
Grk5 A G 19: 60,890,607 T10A probably benign Het
Hivep2 A G 10: 14,131,165 K1169R possibly damaging Het
Ido2 A C 8: 24,540,641 Y224* probably null Het
Ido2 A G 8: 24,548,823 I149T probably damaging Het
Kctd2 A G 11: 115,422,019 T126A possibly damaging Het
Kif1a T C 1: 93,041,583 D1090G probably benign Het
Klrb1a A T 6: 128,609,734 H222Q possibly damaging Het
Kndc1 A C 7: 139,920,783 H688P probably damaging Het
Lrriq1 C A 10: 103,223,750 V141F possibly damaging Het
Malrd1 A G 2: 16,101,911 I1845V unknown Het
Mob3c G A 4: 115,831,684 R138H probably benign Het
Mre11a T A 9: 14,811,913 D394E possibly damaging Het
Myh7b A T 2: 155,622,186 I536F probably damaging Het
Nacad T A 11: 6,598,589 K1382* probably null Het
Ncor1 T C 11: 62,384,772 K128R possibly damaging Het
Olfr1349 T C 7: 6,514,521 N303D probably damaging Het
Ostn T A 16: 27,346,969 probably null Het
Pacs1 G A 19: 5,138,975 T793I probably damaging Het
Pcdhb2 T C 18: 37,296,494 S507P probably damaging Het
Pde2a A G 7: 101,503,390 K393E possibly damaging Het
Pfkl T A 10: 77,989,589 N656Y probably damaging Het
Phf20 T A 2: 156,293,411 probably null Het
Plekha6 G T 1: 133,275,848 E550* probably null Het
Plxna4 A T 6: 32,162,160 V1691E probably damaging Het
Rag1 A T 2: 101,641,778 H1006Q probably damaging Het
Rfx4 C T 10: 84,905,055 P679L probably benign Het
Ripor2 A G 13: 24,694,145 H301R probably damaging Het
Rrp12 A T 19: 41,883,438 I469N possibly damaging Het
Serpinb6b A G 13: 32,977,576 T211A probably benign Het
Sf1 A T 19: 6,376,353 H547L unknown Het
Slc29a1 T C 17: 45,592,182 D9G probably damaging Het
Sptan1 T A 2: 30,002,299 M1075K probably benign Het
Syngap1 A G 17: 26,957,767 D474G probably damaging Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Timeless A G 10: 128,252,001 T1148A probably benign Het
Tmem116 A T 5: 121,463,836 probably null Het
Tmem158 A T 9: 123,260,325 I74N probably damaging Het
Traf5 T A 1: 192,059,017 D174V probably benign Het
Trim65 A T 11: 116,127,708 I247N probably benign Het
Tsfm A T 10: 127,011,631 V197E probably benign Het
Utrn A G 10: 12,728,818 C539R possibly damaging Het
Vps13a A T 19: 16,678,042 F1874Y probably benign Het
Wdr6 A G 9: 108,576,039 M215T possibly damaging Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h7b A G 15: 81,771,787 D112G possibly damaging Het
Zc3hav1 C T 6: 38,353,976 D83N probably benign Het
Zfp369 T A 13: 65,296,117 V358E probably damaging Het
Zfp946 T A 17: 22,453,508 C29* probably null Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 45145513 missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 45141967 missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 45142093 missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 45145594 missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 45141975 missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 45141982 missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 45147979 missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 45142838 missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 45146229 splice site probably null
R0707:Aldh16a1 UTSW 7 45144507 unclassified probably benign
R0801:Aldh16a1 UTSW 7 45147476 missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 45142047 splice site probably null
R1371:Aldh16a1 UTSW 7 45147250 missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 45147308 missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 45147161 critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 45148788 intron probably benign
R4859:Aldh16a1 UTSW 7 45147307 missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 45142069 missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 45144652 missense probably null 0.82
R5647:Aldh16a1 UTSW 7 45154465 missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 45147799 missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 45154407 unclassified probably benign
R5879:Aldh16a1 UTSW 7 45147506 nonsense probably null
R5890:Aldh16a1 UTSW 7 45144545 missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 45149765 missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 45146271 missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 45144937 missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 45143227 missense probably benign 0.22
R7303:Aldh16a1 UTSW 7 45147904 missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 45145907 missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 45147531 missense unknown
R7830:Aldh16a1 UTSW 7 45146225 missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 45141982 missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 45149691 missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 45142014 missense probably benign
Z1177:Aldh16a1 UTSW 7 45145903 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGTACACTAAGAACTGGAGACCC -3'
(R):5'- GGCACAGTGTGGATCAATGC -3'

Sequencing Primer
(F):5'- CTGGAGACCCCAAGACAGG -3'
(R):5'- CACAGTGTGGATCAATGCTCATG -3'
Posted On2019-06-26