Incidental Mutation 'R7248:Aldh16a1'
ID 563677
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Name aldehyde dehydrogenase 16 family, member A1
Synonyms 2410004H02Rik
MMRRC Submission 045311-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7248 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44791257-44804008 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44795018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 484 (Y484H)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107815
AA Change: Y484H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: Y484H

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably damaging
Transcript: ENSMUST00000209963
AA Change: Y484H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,207,959 (GRCm39) probably null Het
Arhgap26 T C 18: 39,439,907 (GRCm39) probably null Het
Atxn7l1 A G 12: 33,417,194 (GRCm39) T452A probably benign Het
Baz1a C T 12: 54,947,293 (GRCm39) E1119K probably damaging Het
Btaf1 A T 19: 36,922,714 (GRCm39) E39D possibly damaging Het
Bud13 G T 9: 46,194,413 (GRCm39) E29* probably null Het
Ccdc150 C T 1: 54,344,057 (GRCm39) T530I probably benign Het
Chd6 G A 2: 160,803,199 (GRCm39) Q2160* probably null Het
Cluap1 T A 16: 3,737,364 (GRCm39) I172N possibly damaging Het
Cnot2 T C 10: 116,334,278 (GRCm39) N329S probably benign Het
Cog4 A T 8: 111,608,834 (GRCm39) T175S unknown Het
Coq7 C A 7: 118,128,897 (GRCm39) R46L probably benign Het
D630045J12Rik A T 6: 38,145,198 (GRCm39) V1276E probably damaging Het
Dcaf15 A G 8: 84,829,394 (GRCm39) V116A possibly damaging Het
Ddr2 C T 1: 169,822,198 (GRCm39) V417I probably benign Het
Defa25 G A 8: 21,575,216 (GRCm39) C65Y probably damaging Het
Dhx38 T C 8: 110,285,559 (GRCm39) T425A probably benign Het
Diaph1 T C 18: 38,022,829 (GRCm39) T782A probably benign Het
Dnah7b T A 1: 46,181,245 (GRCm39) M1044K possibly damaging Het
Dusp16 G A 6: 134,695,940 (GRCm39) T297M probably benign Het
Esyt2 A G 12: 116,305,858 (GRCm39) N363D probably damaging Het
Fasl C T 1: 161,615,760 (GRCm39) C32Y possibly damaging Het
Flg T C 3: 93,189,041 (GRCm39) V137A probably benign Het
Gm57858 T A 3: 36,080,086 (GRCm39) T224S probably benign Het
Gpr150 G A 13: 76,204,126 (GRCm39) A273V probably benign Het
Grk5 A G 19: 60,879,045 (GRCm39) T10A probably benign Het
Hivep2 A G 10: 14,006,909 (GRCm39) K1169R possibly damaging Het
Ido2 A C 8: 25,030,657 (GRCm39) Y224* probably null Het
Ido2 A G 8: 25,038,839 (GRCm39) I149T probably damaging Het
Iqca1l C T 5: 24,749,269 (GRCm39) S743N probably benign Het
Kctd2 A G 11: 115,312,845 (GRCm39) T126A possibly damaging Het
Khdc4 T C 3: 88,600,886 (GRCm39) S228P probably damaging Het
Kif1a T C 1: 92,969,305 (GRCm39) D1090G probably benign Het
Klrb1a A T 6: 128,586,697 (GRCm39) H222Q possibly damaging Het
Kndc1 A C 7: 139,500,699 (GRCm39) H688P probably damaging Het
Lrriq1 C A 10: 103,059,611 (GRCm39) V141F possibly damaging Het
Malrd1 A G 2: 16,106,722 (GRCm39) I1845V unknown Het
Mob3c G A 4: 115,688,881 (GRCm39) R138H probably benign Het
Mre11a T A 9: 14,723,209 (GRCm39) D394E possibly damaging Het
Myh7b A T 2: 155,464,106 (GRCm39) I536F probably damaging Het
Nacad T A 11: 6,548,589 (GRCm39) K1382* probably null Het
Ncor1 T C 11: 62,275,598 (GRCm39) K128R possibly damaging Het
Or10am5 T C 7: 6,517,520 (GRCm39) N303D probably damaging Het
Ostn T A 16: 27,165,719 (GRCm39) probably null Het
Pacs1 G A 19: 5,189,003 (GRCm39) T793I probably damaging Het
Pcdhb2 T C 18: 37,429,547 (GRCm39) S507P probably damaging Het
Pde2a A G 7: 101,152,597 (GRCm39) K393E possibly damaging Het
Pfkl T A 10: 77,825,423 (GRCm39) N656Y probably damaging Het
Phf20 T A 2: 156,135,331 (GRCm39) probably null Het
Plekha6 G T 1: 133,203,586 (GRCm39) E550* probably null Het
Plxna4 A T 6: 32,139,095 (GRCm39) V1691E probably damaging Het
Rag1 A T 2: 101,472,123 (GRCm39) H1006Q probably damaging Het
Rfx4 C T 10: 84,740,919 (GRCm39) P679L probably benign Het
Ripor2 A G 13: 24,878,128 (GRCm39) H301R probably damaging Het
Rrp12 A T 19: 41,871,877 (GRCm39) I469N possibly damaging Het
Serpinb6b A G 13: 33,161,559 (GRCm39) T211A probably benign Het
Sf1 A T 19: 6,426,383 (GRCm39) H547L unknown Het
Slc29a1 T C 17: 45,903,108 (GRCm39) D9G probably damaging Het
Sptan1 T A 2: 29,892,311 (GRCm39) M1075K probably benign Het
Syngap1 A G 17: 27,176,741 (GRCm39) D474G probably damaging Het
Syt16 C T 12: 74,313,483 (GRCm39) R470C probably damaging Het
Timeless A G 10: 128,087,870 (GRCm39) T1148A probably benign Het
Tmem116 A T 5: 121,601,899 (GRCm39) probably null Het
Tmem158 A T 9: 123,089,390 (GRCm39) I74N probably damaging Het
Traf5 T A 1: 191,743,432 (GRCm39) D174V probably benign Het
Trim65 A T 11: 116,018,534 (GRCm39) I247N probably benign Het
Tsfm A T 10: 126,847,500 (GRCm39) V197E probably benign Het
Utrn A G 10: 12,604,562 (GRCm39) C539R possibly damaging Het
Vps13a A T 19: 16,655,406 (GRCm39) F1874Y probably benign Het
Wdr6 A G 9: 108,453,238 (GRCm39) M215T possibly damaging Het
Wdr75 T A 1: 45,856,560 (GRCm39) W528R probably damaging Het
Zc3h7b A G 15: 81,655,988 (GRCm39) D112G possibly damaging Het
Zc3hav1 C T 6: 38,330,911 (GRCm39) D83N probably benign Het
Zfp369 T A 13: 65,443,931 (GRCm39) V358E probably damaging Het
Zfp946 T A 17: 22,672,489 (GRCm39) C29* probably null Het
Zng1 A G 19: 24,898,505 (GRCm39) S318P probably damaging Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 44,794,937 (GRCm39) missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 44,791,391 (GRCm39) missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 44,791,517 (GRCm39) missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 44,795,018 (GRCm39) missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 44,791,399 (GRCm39) missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 44,797,403 (GRCm39) missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 44,792,262 (GRCm39) missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 44,795,653 (GRCm39) splice site probably null
R0707:Aldh16a1 UTSW 7 44,793,931 (GRCm39) unclassified probably benign
R0801:Aldh16a1 UTSW 7 44,796,900 (GRCm39) missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 44,791,471 (GRCm39) splice site probably null
R1371:Aldh16a1 UTSW 7 44,796,674 (GRCm39) missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 44,796,732 (GRCm39) missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 44,796,585 (GRCm39) critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 44,798,212 (GRCm39) intron probably benign
R4859:Aldh16a1 UTSW 7 44,796,731 (GRCm39) missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 44,791,493 (GRCm39) missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 44,794,076 (GRCm39) missense probably null 0.82
R5647:Aldh16a1 UTSW 7 44,803,889 (GRCm39) missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 44,797,223 (GRCm39) missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 44,803,831 (GRCm39) unclassified probably benign
R5879:Aldh16a1 UTSW 7 44,796,930 (GRCm39) nonsense probably null
R5890:Aldh16a1 UTSW 7 44,793,969 (GRCm39) missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 44,799,189 (GRCm39) missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 44,795,695 (GRCm39) missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 44,794,361 (GRCm39) missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 44,792,651 (GRCm39) missense probably benign 0.22
R7303:Aldh16a1 UTSW 7 44,797,328 (GRCm39) missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 44,795,331 (GRCm39) missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 44,796,955 (GRCm39) missense unknown
R7830:Aldh16a1 UTSW 7 44,795,649 (GRCm39) missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 44,799,115 (GRCm39) missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 44,791,438 (GRCm39) missense probably benign
R9011:Aldh16a1 UTSW 7 44,794,951 (GRCm39) missense probably damaging 0.98
R9187:Aldh16a1 UTSW 7 44,791,441 (GRCm39) missense probably damaging 0.99
R9620:Aldh16a1 UTSW 7 44,797,413 (GRCm39) nonsense probably null
Z1177:Aldh16a1 UTSW 7 44,795,327 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGTACACTAAGAACTGGAGACCC -3'
(R):5'- GGCACAGTGTGGATCAATGC -3'

Sequencing Primer
(F):5'- CTGGAGACCCCAAGACAGG -3'
(R):5'- CACAGTGTGGATCAATGCTCATG -3'
Posted On 2019-06-26