Mutagenetix > Incidental Mutations

Incidental Mutation 'R0579:Pop1'

56368

Institutional Source

Beutler Lab

Gene Symbol

Pop1

Ensembl Gene

ENSMUSG00000022325

Gene Name

processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)

Synonyms

4932434G09Rik

MMRRC Submission

038769-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R0579 (G1)

Quality Score

203

Status

Validated

Chromosome

Chromosomal Location

34495304-34530648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34509969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 406 (D406E)

Ref Sequence

ENSEMBL: ENSMUSP00000078037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]

AlphaFold

Q8K205

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052290
AA Change: D406E

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: D406E

Domain	Start	End	E-Value	Type
Pfam:POP1	107	190	6.2e-21	PFAM
Pfam:POP1	179	257	2.5e-23	PFAM
low complexity region	382	387	N/A	INTRINSIC
Pfam:POPLD	647	738	1.4e-30	PFAM
low complexity region	931	940	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079028
AA Change: D406E

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: D406E

Domain	Start	End	E-Value	Type
Pfam:POP1	107	258	1e-46	PFAM
low complexity region	382	387	N/A	INTRINSIC
Pfam:POPLD	617	708	1.2e-34	PFAM
low complexity region	901	910	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155073

Meta Mutation Damage Score

0.0820

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.7%

Validation Efficiency

89% (34/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	GCC	GC	13: 59,691,598		probably null	Het
Abcf3	G	A	16: 20,550,648	R260Q	probably benign	Het
Abcg3	A	G	5: 104,974,103	V136A	probably damaging	Het
Acr	C	G	15: 89,569,475	H72Q	probably damaging	Het
Ambra1	A	G	2: 91,824,465	N783S	possibly damaging	Het
Cd300ld2	A	G	11: 115,012,299	F240S	probably benign	Het
Cep83	A	G	10: 94,749,053	D340G	possibly damaging	Het
Crybg2	T	A	4: 134,072,738	I403N	probably damaging	Het
Dnah14	T	A	1: 181,744,747	M2881K	possibly damaging	Het
Erbb4	T	C	1: 68,042,462	M1138V	probably benign	Het
Evi5	A	G	5: 107,821,709	V112A	probably benign	Het
F2r	A	G	13: 95,618,349	V9A	probably benign	Het
Flot1	C	A	17: 35,831,008	S337R	probably benign	Het
Glt28d2	G	A	3: 85,872,133	T11I	probably damaging	Het
Gm19345	A	G	7: 19,854,976		probably benign	Het
Gm6605	C	A	7: 38,448,275		noncoding transcript	Het
Hmgcs2	A	T	3: 98,290,948	I56F	probably damaging	Het
Ifna9	T	A	4: 88,592,271	T39S	possibly damaging	Het
Il21	T	G	3: 37,227,774	K74Q	possibly damaging	Het
Itpripl1	G	T	2: 127,141,091	Y370*	probably null	Het
Kif24	G	A	4: 41,393,706	P1056S	probably damaging	Het
L2hgdh	A	T	12: 69,701,272		probably benign	Het
Lipo2	A	T	19: 33,746,898	L156Q	probably damaging	Het
Nlrp4c	T	A	7: 6,060,845	M84K	probably benign	Het
Npy4r	G	A	14: 34,146,683	T216I	probably benign	Het
Olfr109	T	C	17: 37,466,347	V47A	probably benign	Het
Olfr802	A	T	10: 129,682,237	C167*	probably null	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pafah1b2	T	C	9: 45,968,713	E222G	probably benign	Het
Proser1	A	G	3: 53,467,151	Y32C	probably damaging	Het
Ptprj	C	A	2: 90,436,569		probably null	Het
Slc1a3	T	A	15: 8,688,309	I100F	probably damaging	Het
Slc25a22	T	C	7: 141,431,359	D176G	probably damaging	Het
Stard7	T	C	2: 127,284,553	V99A	probably damaging	Het
Stk33	C	T	7: 109,325,697	V184I	probably damaging	Het
Timmdc1	A	G	16: 38,522,383	L51P	probably benign	Het
Tppp	T	C	13: 74,021,233	S31P	probably benign	Het
Upf2	A	T	2: 5,988,429	R599W	unknown	Het
Vav1	G	T	17: 57,279,271	W25L	probably benign	Het

Other mutations in Pop1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Pop1	APN	15	34508729	missense	probably benign	0.00
IGL02192:Pop1	APN	15	34529071	missense	probably benign	0.08
IGL02680:Pop1	APN	15	34502473	missense	probably damaging	0.99
IGL02958:Pop1	APN	15	34530363	missense	probably damaging	0.99
H8562:Pop1	UTSW	15	34530212	missense	probably benign	0.00
PIT4802001:Pop1	UTSW	15	34529083	missense	probably benign	0.00
R0244:Pop1	UTSW	15	34515891	nonsense	probably null
R0281:Pop1	UTSW	15	34529858	splice site	probably null
R0453:Pop1	UTSW	15	34526206	missense	possibly damaging	0.82
R1054:Pop1	UTSW	15	34509809	missense	probably benign	0.30
R1501:Pop1	UTSW	15	34510357	missense	probably benign	0.01
R1614:Pop1	UTSW	15	34530210	missense	possibly damaging	0.46
R1994:Pop1	UTSW	15	34530471	missense	probably damaging	1.00
R2084:Pop1	UTSW	15	34508598	splice site	probably benign
R4020:Pop1	UTSW	15	34508780	missense	probably benign	0.01
R4550:Pop1	UTSW	15	34528936	missense	probably damaging	1.00
R4579:Pop1	UTSW	15	34515824	intron	probably benign
R5672:Pop1	UTSW	15	34530179	missense	possibly damaging	0.63
R6139:Pop1	UTSW	15	34529058	missense	probably benign	0.26
R6161:Pop1	UTSW	15	34526310	missense	probably damaging	1.00
R6821:Pop1	UTSW	15	34508639	missense	possibly damaging	0.86
R7053:Pop1	UTSW	15	34530275	missense	probably benign	0.01
R7195:Pop1	UTSW	15	34510379	missense	probably damaging	0.97
R7543:Pop1	UTSW	15	34530447	missense	probably damaging	1.00
R7571:Pop1	UTSW	15	34528947	missense	probably null	1.00
R7587:Pop1	UTSW	15	34502413	missense	probably damaging	0.97
R8401:Pop1	UTSW	15	34508609	missense	probably damaging	1.00
R8406:Pop1	UTSW	15	34529170	missense	probably benign
R8707:Pop1	UTSW	15	34529203	missense	probably benign	0.02
R9044:Pop1	UTSW	15	34530408	missense	possibly damaging	0.94
R9066:Pop1	UTSW	15	34515914	missense	possibly damaging	0.68
R9236:Pop1	UTSW	15	34499412	missense	probably damaging	0.98
RF001:Pop1	UTSW	15	34502437	missense	probably damaging	1.00
RF002:Pop1	UTSW	15	34502437	missense	probably damaging	1.00
Z1088:Pop1	UTSW	15	34499319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCACTGTTCAGAACCCGTC -3'
(R):5'- GCCGGAACCTGTTCATCTCCATTG -3'

Sequencing Primer
(F):5'- TGTTCAGAACCCGTCAAGTC -3'
(R):5'- tggcacacagcacaagg -3'

Posted On

2013-07-11