Incidental Mutation 'R7248:Kndc1'
ID 563680
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 045311-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7248 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 139500699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 688 (H688P)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: H688P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: H688P

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,207,959 (GRCm39) probably null Het
Aldh16a1 A G 7: 44,795,018 (GRCm39) Y484H probably damaging Het
Arhgap26 T C 18: 39,439,907 (GRCm39) probably null Het
Atxn7l1 A G 12: 33,417,194 (GRCm39) T452A probably benign Het
Baz1a C T 12: 54,947,293 (GRCm39) E1119K probably damaging Het
Btaf1 A T 19: 36,922,714 (GRCm39) E39D possibly damaging Het
Bud13 G T 9: 46,194,413 (GRCm39) E29* probably null Het
Ccdc150 C T 1: 54,344,057 (GRCm39) T530I probably benign Het
Chd6 G A 2: 160,803,199 (GRCm39) Q2160* probably null Het
Cluap1 T A 16: 3,737,364 (GRCm39) I172N possibly damaging Het
Cnot2 T C 10: 116,334,278 (GRCm39) N329S probably benign Het
Cog4 A T 8: 111,608,834 (GRCm39) T175S unknown Het
Coq7 C A 7: 118,128,897 (GRCm39) R46L probably benign Het
D630045J12Rik A T 6: 38,145,198 (GRCm39) V1276E probably damaging Het
Dcaf15 A G 8: 84,829,394 (GRCm39) V116A possibly damaging Het
Ddr2 C T 1: 169,822,198 (GRCm39) V417I probably benign Het
Defa25 G A 8: 21,575,216 (GRCm39) C65Y probably damaging Het
Dhx38 T C 8: 110,285,559 (GRCm39) T425A probably benign Het
Diaph1 T C 18: 38,022,829 (GRCm39) T782A probably benign Het
Dnah7b T A 1: 46,181,245 (GRCm39) M1044K possibly damaging Het
Dusp16 G A 6: 134,695,940 (GRCm39) T297M probably benign Het
Esyt2 A G 12: 116,305,858 (GRCm39) N363D probably damaging Het
Fasl C T 1: 161,615,760 (GRCm39) C32Y possibly damaging Het
Flg T C 3: 93,189,041 (GRCm39) V137A probably benign Het
Gm57858 T A 3: 36,080,086 (GRCm39) T224S probably benign Het
Gpr150 G A 13: 76,204,126 (GRCm39) A273V probably benign Het
Grk5 A G 19: 60,879,045 (GRCm39) T10A probably benign Het
Hivep2 A G 10: 14,006,909 (GRCm39) K1169R possibly damaging Het
Ido2 A C 8: 25,030,657 (GRCm39) Y224* probably null Het
Ido2 A G 8: 25,038,839 (GRCm39) I149T probably damaging Het
Iqca1l C T 5: 24,749,269 (GRCm39) S743N probably benign Het
Kctd2 A G 11: 115,312,845 (GRCm39) T126A possibly damaging Het
Khdc4 T C 3: 88,600,886 (GRCm39) S228P probably damaging Het
Kif1a T C 1: 92,969,305 (GRCm39) D1090G probably benign Het
Klrb1a A T 6: 128,586,697 (GRCm39) H222Q possibly damaging Het
Lrriq1 C A 10: 103,059,611 (GRCm39) V141F possibly damaging Het
Malrd1 A G 2: 16,106,722 (GRCm39) I1845V unknown Het
Mob3c G A 4: 115,688,881 (GRCm39) R138H probably benign Het
Mre11a T A 9: 14,723,209 (GRCm39) D394E possibly damaging Het
Myh7b A T 2: 155,464,106 (GRCm39) I536F probably damaging Het
Nacad T A 11: 6,548,589 (GRCm39) K1382* probably null Het
Ncor1 T C 11: 62,275,598 (GRCm39) K128R possibly damaging Het
Or10am5 T C 7: 6,517,520 (GRCm39) N303D probably damaging Het
Ostn T A 16: 27,165,719 (GRCm39) probably null Het
Pacs1 G A 19: 5,189,003 (GRCm39) T793I probably damaging Het
Pcdhb2 T C 18: 37,429,547 (GRCm39) S507P probably damaging Het
Pde2a A G 7: 101,152,597 (GRCm39) K393E possibly damaging Het
Pfkl T A 10: 77,825,423 (GRCm39) N656Y probably damaging Het
Phf20 T A 2: 156,135,331 (GRCm39) probably null Het
Plekha6 G T 1: 133,203,586 (GRCm39) E550* probably null Het
Plxna4 A T 6: 32,139,095 (GRCm39) V1691E probably damaging Het
Rag1 A T 2: 101,472,123 (GRCm39) H1006Q probably damaging Het
Rfx4 C T 10: 84,740,919 (GRCm39) P679L probably benign Het
Ripor2 A G 13: 24,878,128 (GRCm39) H301R probably damaging Het
Rrp12 A T 19: 41,871,877 (GRCm39) I469N possibly damaging Het
Serpinb6b A G 13: 33,161,559 (GRCm39) T211A probably benign Het
Sf1 A T 19: 6,426,383 (GRCm39) H547L unknown Het
Slc29a1 T C 17: 45,903,108 (GRCm39) D9G probably damaging Het
Sptan1 T A 2: 29,892,311 (GRCm39) M1075K probably benign Het
Syngap1 A G 17: 27,176,741 (GRCm39) D474G probably damaging Het
Syt16 C T 12: 74,313,483 (GRCm39) R470C probably damaging Het
Timeless A G 10: 128,087,870 (GRCm39) T1148A probably benign Het
Tmem116 A T 5: 121,601,899 (GRCm39) probably null Het
Tmem158 A T 9: 123,089,390 (GRCm39) I74N probably damaging Het
Traf5 T A 1: 191,743,432 (GRCm39) D174V probably benign Het
Trim65 A T 11: 116,018,534 (GRCm39) I247N probably benign Het
Tsfm A T 10: 126,847,500 (GRCm39) V197E probably benign Het
Utrn A G 10: 12,604,562 (GRCm39) C539R possibly damaging Het
Vps13a A T 19: 16,655,406 (GRCm39) F1874Y probably benign Het
Wdr6 A G 9: 108,453,238 (GRCm39) M215T possibly damaging Het
Wdr75 T A 1: 45,856,560 (GRCm39) W528R probably damaging Het
Zc3h7b A G 15: 81,655,988 (GRCm39) D112G possibly damaging Het
Zc3hav1 C T 6: 38,330,911 (GRCm39) D83N probably benign Het
Zfp369 T A 13: 65,443,931 (GRCm39) V358E probably damaging Het
Zfp946 T A 17: 22,672,489 (GRCm39) C29* probably null Het
Zng1 A G 19: 24,898,505 (GRCm39) S318P probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACCTTAGTGTGGAGTCACTC -3'
(R):5'- TGTCCAGATGACCACTTCCC -3'

Sequencing Primer
(F):5'- TGGAGTCACTCAAAAGTATCCGCTG -3'
(R):5'- AGATGACCACTTCCCTCTTTGG -3'
Posted On 2019-06-26