Mutagenetix > Incidental Mutation

Incidental Mutation 'R7248:Mre11a'

563687

Institutional Source

Beutler Lab

Gene Symbol

Mre11a

Ensembl Gene

ENSMUSG00000031928

Gene Name

MRE11A homolog A, double strand break repair nuclease

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14784654-14837123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14811913 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 394 (D394E)

Ref Sequence

ENSEMBL: ENSMUSP00000034405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632]

AlphaFold

Q61216

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034405
AA Change: D394E

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: D394E

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	6.3e-15	PFAM
Mre11_DNA_bind	294	462	1.72e-70	SMART
coiled coil region	487	519	N/A	INTRINSIC
low complexity region	566	594	N/A	INTRINSIC
low complexity region	683	699	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115632
AA Change: D367E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: D367E

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	1.1e-31	PFAM
Mre11_DNA_bind	294	435	7.6e-49	SMART
coiled coil region	460	492	N/A	INTRINSIC
low complexity region	539	567	N/A	INTRINSIC
low complexity region	656	672	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: D161E

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	2	50	3e-26	PDB
Mre11_DNA_bind	62	170	1.81e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,310		probably null	Het
2810403A07Rik	T	C	3: 88,693,579	S228P	probably damaging	Het
4931409K22Rik	C	T	5: 24,544,271	S743N	probably benign	Het
Aldh16a1	A	G	7: 45,145,594	Y484H	probably damaging	Het
Arhgap26	T	C	18: 39,306,854		probably null	Het
Atxn7l1	A	G	12: 33,367,195	T452A	probably benign	Het
Baz1a	C	T	12: 54,900,508	E1119K	probably damaging	Het
Btaf1	A	T	19: 36,945,314	E39D	possibly damaging	Het
Bud13	G	T	9: 46,283,115	E29*	probably null	Het
Cbwd1	A	G	19: 24,921,141	S318P	probably damaging	Het
Ccdc144b	T	A	3: 36,025,937	T224S	probably benign	Het
Ccdc150	C	T	1: 54,304,898	T530I	probably benign	Het
Chd6	G	A	2: 160,961,279	Q2160*	probably null	Het
Cluap1	T	A	16: 3,919,500	I172N	possibly damaging	Het
Cnot2	T	C	10: 116,498,373	N329S	probably benign	Het
Cog4	A	T	8: 110,882,202	T175S	unknown	Het
Coq7	C	A	7: 118,529,674	R46L	probably benign	Het
D630045J12Rik	A	T	6: 38,168,263	V1276E	probably damaging	Het
Dcaf15	A	G	8: 84,102,765	V116A	possibly damaging	Het
Ddr2	C	T	1: 169,994,629	V417I	probably benign	Het
Defa25	G	A	8: 21,085,200	C65Y	probably damaging	Het
Dhx38	T	C	8: 109,558,927	T425A	probably benign	Het
Diaph1	T	C	18: 37,889,776	T782A	probably benign	Het
Dnah7b	T	A	1: 46,142,085	M1044K	possibly damaging	Het
Dusp16	G	A	6: 134,718,977	T297M	probably benign	Het
Esyt2	A	G	12: 116,342,238	N363D	probably damaging	Het
Fasl	C	T	1: 161,788,191	C32Y	possibly damaging	Het
Flg	T	C	3: 93,281,734	V137A	probably benign	Het
Gpr150	G	A	13: 76,056,007	A273V	probably benign	Het
Grk5	A	G	19: 60,890,607	T10A	probably benign	Het
Hivep2	A	G	10: 14,131,165	K1169R	possibly damaging	Het
Ido2	A	C	8: 24,540,641	Y224*	probably null	Het
Ido2	A	G	8: 24,548,823	I149T	probably damaging	Het
Kctd2	A	G	11: 115,422,019	T126A	possibly damaging	Het
Kif1a	T	C	1: 93,041,583	D1090G	probably benign	Het
Klrb1a	A	T	6: 128,609,734	H222Q	possibly damaging	Het
Kndc1	A	C	7: 139,920,783	H688P	probably damaging	Het
Lrriq1	C	A	10: 103,223,750	V141F	possibly damaging	Het
Malrd1	A	G	2: 16,101,911	I1845V	unknown	Het
Mob3c	G	A	4: 115,831,684	R138H	probably benign	Het
Myh7b	A	T	2: 155,622,186	I536F	probably damaging	Het
Nacad	T	A	11: 6,598,589	K1382*	probably null	Het
Ncor1	T	C	11: 62,384,772	K128R	possibly damaging	Het
Olfr1349	T	C	7: 6,514,521	N303D	probably damaging	Het
Ostn	T	A	16: 27,346,969		probably null	Het
Pacs1	G	A	19: 5,138,975	T793I	probably damaging	Het
Pcdhb2	T	C	18: 37,296,494	S507P	probably damaging	Het
Pde2a	A	G	7: 101,503,390	K393E	possibly damaging	Het
Pfkl	T	A	10: 77,989,589	N656Y	probably damaging	Het
Phf20	T	A	2: 156,293,411		probably null	Het
Plekha6	G	T	1: 133,275,848	E550*	probably null	Het
Plxna4	A	T	6: 32,162,160	V1691E	probably damaging	Het
Rag1	A	T	2: 101,641,778	H1006Q	probably damaging	Het
Rfx4	C	T	10: 84,905,055	P679L	probably benign	Het
Ripor2	A	G	13: 24,694,145	H301R	probably damaging	Het
Rrp12	A	T	19: 41,883,438	I469N	possibly damaging	Het
Serpinb6b	A	G	13: 32,977,576	T211A	probably benign	Het
Sf1	A	T	19: 6,376,353	H547L	unknown	Het
Slc29a1	T	C	17: 45,592,182	D9G	probably damaging	Het
Sptan1	T	A	2: 30,002,299	M1075K	probably benign	Het
Syngap1	A	G	17: 26,957,767	D474G	probably damaging	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Timeless	A	G	10: 128,252,001	T1148A	probably benign	Het
Tmem116	A	T	5: 121,463,836		probably null	Het
Tmem158	A	T	9: 123,260,325	I74N	probably damaging	Het
Traf5	T	A	1: 192,059,017	D174V	probably benign	Het
Trim65	A	T	11: 116,127,708	I247N	probably benign	Het
Tsfm	A	T	10: 127,011,631	V197E	probably benign	Het
Utrn	A	G	10: 12,728,818	C539R	possibly damaging	Het
Vps13a	A	T	19: 16,678,042	F1874Y	probably benign	Het
Wdr6	A	G	9: 108,576,039	M215T	possibly damaging	Het
Wdr75	T	A	1: 45,817,400	W528R	probably damaging	Het
Zc3h7b	A	G	15: 81,771,787	D112G	possibly damaging	Het
Zc3hav1	C	T	6: 38,353,976	D83N	probably benign	Het
Zfp369	T	A	13: 65,296,117	V358E	probably damaging	Het
Zfp946	T	A	17: 22,453,508	C29*	probably null	Het

Other mutations in Mre11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Mre11a	APN	9	14825208	missense	probably benign	0.28
IGL00429:Mre11a	APN	9	14802813	missense	probably damaging	1.00
IGL00922:Mre11a	APN	9	14799588	missense	probably damaging	1.00
IGL01095:Mre11a	APN	9	14809824	missense	probably benign
IGL01294:Mre11a	APN	9	14830915	missense	probably damaging	0.97
IGL01871:Mre11a	APN	9	14811897	missense	possibly damaging	0.95
IGL02194:Mre11a	APN	9	14815209	missense	possibly damaging	0.70
IGL02213:Mre11a	APN	9	14811884	missense	probably damaging	1.00
IGL02245:Mre11a	APN	9	14815276	unclassified	probably benign
IGL02749:Mre11a	APN	9	14826591	missense	possibly damaging	0.78
IGL02812:Mre11a	APN	9	14790670	splice site	probably null
bow	UTSW	9	14786962	missense	probably damaging	1.00
R0050:Mre11a	UTSW	9	14830973	splice site	probably benign
R0594:Mre11a	UTSW	9	14815209	missense	probably benign	0.00
R1241:Mre11a	UTSW	9	14799639	missense	probably damaging	1.00
R1905:Mre11a	UTSW	9	14799627	missense	probably benign	0.08
R2030:Mre11a	UTSW	9	14795805	missense	probably damaging	1.00
R2270:Mre11a	UTSW	9	14815174	missense	probably benign	0.00
R2511:Mre11a	UTSW	9	14795769	critical splice acceptor site	probably null
R2851:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2852:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2853:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R3765:Mre11a	UTSW	9	14809847	missense	probably benign	0.25
R4612:Mre11a	UTSW	9	14802903	missense	probably damaging	1.00
R5007:Mre11a	UTSW	9	14809820	missense	probably benign	0.10
R5343:Mre11a	UTSW	9	14811834	missense	probably damaging	0.98
R5679:Mre11a	UTSW	9	14786919	missense	probably damaging	0.99
R5834:Mre11a	UTSW	9	14799657	missense	probably benign	0.15
R5914:Mre11a	UTSW	9	14811936	missense	probably damaging	1.00
R5935:Mre11a	UTSW	9	14786962	missense	probably damaging	1.00
R6089:Mre11a	UTSW	9	14819464	missense	probably benign	0.02
R6393:Mre11a	UTSW	9	14785509	start codon destroyed	probably null	0.00
R6625:Mre11a	UTSW	9	14805391	missense	possibly damaging	0.52
R7744:Mre11a	UTSW	9	14809832	missense	possibly damaging	0.94
R7999:Mre11a	UTSW	9	14799669	nonsense	probably null
R8179:Mre11a	UTSW	9	14797066	missense	probably null	1.00
R9293:Mre11a	UTSW	9	14799588	missense	probably damaging	1.00
R9302:Mre11a	UTSW	9	14785530	critical splice donor site	probably null
R9368:Mre11a	UTSW	9	14825218	missense	probably benign
R9410:Mre11a	UTSW	9	14805420	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTATACATGCAGACTATAGAGGCC -3'
(R):5'- AAACCACGTGTCTCAAGCCATG -3'

Sequencing Primer
(F):5'- GTCTTTCCAGGTGGACTA -3'
(R):5'- ATCGGTACATGCCTGCAGTC -3'

Posted On

2019-06-26