Mutagenetix > Incidental Mutations

Incidental Mutation 'R7248:Lrriq1'

563695

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R7248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103223750 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 141 (V141F)

Ref Sequence

ENSEMBL: ENSMUSP00000020043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020043
AA Change: V141F

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: V141F

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123364
AA Change: V141F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: V141F

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166240
AA Change: V141F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: V141F

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

97% (75/77)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,310		probably null	Het
2810403A07Rik	T	C	3: 88,693,579	S228P	probably damaging	Het
4931409K22Rik	C	T	5: 24,544,271	S743N	probably benign	Het
Aldh16a1	A	G	7: 45,145,594	Y484H	probably damaging	Het
Arhgap26	T	C	18: 39,306,854		probably null	Het
Atxn7l1	A	G	12: 33,367,195	T452A	probably benign	Het
Baz1a	C	T	12: 54,900,508	E1119K	probably damaging	Het
Btaf1	A	T	19: 36,945,314	E39D	possibly damaging	Het
Bud13	G	T	9: 46,283,115	E29*	probably null	Het
Cbwd1	A	G	19: 24,921,141	S318P	probably damaging	Het
Ccdc144b	T	A	3: 36,025,937	T224S	probably benign	Het
Ccdc150	C	T	1: 54,304,898	T530I	probably benign	Het
Chd6	G	A	2: 160,961,279	Q2160*	probably null	Het
Cluap1	T	A	16: 3,919,500	I172N	possibly damaging	Het
Cnot2	T	C	10: 116,498,373	N329S	probably benign	Het
Cog4	A	T	8: 110,882,202	T175S	unknown	Het
Coq7	C	A	7: 118,529,674	R46L	probably benign	Het
D630045J12Rik	A	T	6: 38,168,263	V1276E	probably damaging	Het
Dcaf15	A	G	8: 84,102,765	V116A	possibly damaging	Het
Ddr2	C	T	1: 169,994,629	V417I	probably benign	Het
Defa25	G	A	8: 21,085,200	C65Y	probably damaging	Het
Dhx38	T	C	8: 109,558,927	T425A	probably benign	Het
Diaph1	T	C	18: 37,889,776	T782A	probably benign	Het
Dnah7b	T	A	1: 46,142,085	M1044K	possibly damaging	Het
Dusp16	G	A	6: 134,718,977	T297M	probably benign	Het
Esyt2	A	G	12: 116,342,238	N363D	probably damaging	Het
Fasl	C	T	1: 161,788,191	C32Y	possibly damaging	Het
Flg	T	C	3: 93,281,734	V137A	probably benign	Het
Gpr150	G	A	13: 76,056,007	A273V	probably benign	Het
Grk5	A	G	19: 60,890,607	T10A	probably benign	Het
Hivep2	A	G	10: 14,131,165	K1169R	possibly damaging	Het
Ido2	A	C	8: 24,540,641	Y224*	probably null	Het
Ido2	A	G	8: 24,548,823	I149T	probably damaging	Het
Kctd2	A	G	11: 115,422,019	T126A	possibly damaging	Het
Kif1a	T	C	1: 93,041,583	D1090G	probably benign	Het
Klrb1a	A	T	6: 128,609,734	H222Q	possibly damaging	Het
Kndc1	A	C	7: 139,920,783	H688P	probably damaging	Het
Malrd1	A	G	2: 16,101,911	I1845V	unknown	Het
Mob3c	G	A	4: 115,831,684	R138H	probably benign	Het
Mre11a	T	A	9: 14,811,913	D394E	possibly damaging	Het
Myh7b	A	T	2: 155,622,186	I536F	probably damaging	Het
Nacad	T	A	11: 6,598,589	K1382*	probably null	Het
Ncor1	T	C	11: 62,384,772	K128R	possibly damaging	Het
Olfr1349	T	C	7: 6,514,521	N303D	probably damaging	Het
Ostn	T	A	16: 27,346,969		probably null	Het
Pacs1	G	A	19: 5,138,975	T793I	probably damaging	Het
Pcdhb2	T	C	18: 37,296,494	S507P	probably damaging	Het
Pde2a	A	G	7: 101,503,390	K393E	possibly damaging	Het
Pfkl	T	A	10: 77,989,589	N656Y	probably damaging	Het
Phf20	T	A	2: 156,293,411		probably null	Het
Plekha6	G	T	1: 133,275,848	E550*	probably null	Het
Plxna4	A	T	6: 32,162,160	V1691E	probably damaging	Het
Rag1	A	T	2: 101,641,778	H1006Q	probably damaging	Het
Rfx4	C	T	10: 84,905,055	P679L	probably benign	Het
Ripor2	A	G	13: 24,694,145	H301R	probably damaging	Het
Rrp12	A	T	19: 41,883,438	I469N	possibly damaging	Het
Serpinb6b	A	G	13: 32,977,576	T211A	probably benign	Het
Sf1	A	T	19: 6,376,353	H547L	unknown	Het
Slc29a1	T	C	17: 45,592,182	D9G	probably damaging	Het
Sptan1	T	A	2: 30,002,299	M1075K	probably benign	Het
Syngap1	A	G	17: 26,957,767	D474G	probably damaging	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Timeless	A	G	10: 128,252,001	T1148A	probably benign	Het
Tmem116	A	T	5: 121,463,836		probably null	Het
Tmem158	A	T	9: 123,260,325	I74N	probably damaging	Het
Traf5	T	A	1: 192,059,017	D174V	probably benign	Het
Trim65	A	T	11: 116,127,708	I247N	probably benign	Het
Tsfm	A	T	10: 127,011,631	V197E	probably benign	Het
Utrn	A	G	10: 12,728,818	C539R	possibly damaging	Het
Vps13a	A	T	19: 16,678,042	F1874Y	probably benign	Het
Wdr6	A	G	9: 108,576,039	M215T	possibly damaging	Het
Wdr75	T	A	1: 45,817,400	W528R	probably damaging	Het
Zc3h7b	A	G	15: 81,771,787	D112G	possibly damaging	Het
Zc3hav1	C	T	6: 38,353,976	D83N	probably benign	Het
Zfp369	T	A	13: 65,296,117	V358E	probably damaging	Het
Zfp946	T	A	17: 22,453,508	C29*	probably null	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R7991:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTTGTCTTTTCTATGTATTCTGGAA -3'
(R):5'- CATCAGGGGCAAGGGACATT -3'

Sequencing Primer
(F):5'- CACACTTCAATACATCGTGT -3'
(R):5'- GGGACATTTTGAAGGGATAATTAAGC -3'

Posted On

2019-06-26