Incidental Mutation 'R7248:Lrriq1'
ID 563695
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms LOC380658, 4930503E15Rik, Gm1557
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7248 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103046031-103236322 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103223750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 141 (V141F)
Ref Sequence ENSEMBL: ENSMUSP00000020043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect possibly damaging
Transcript: ENSMUST00000020043
AA Change: V141F

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: V141F

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123364
AA Change: V141F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: V141F

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166240
AA Change: V141F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: V141F

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,310 probably null Het
2810403A07Rik T C 3: 88,693,579 S228P probably damaging Het
4931409K22Rik C T 5: 24,544,271 S743N probably benign Het
Aldh16a1 A G 7: 45,145,594 Y484H probably damaging Het
Arhgap26 T C 18: 39,306,854 probably null Het
Atxn7l1 A G 12: 33,367,195 T452A probably benign Het
Baz1a C T 12: 54,900,508 E1119K probably damaging Het
Btaf1 A T 19: 36,945,314 E39D possibly damaging Het
Bud13 G T 9: 46,283,115 E29* probably null Het
Cbwd1 A G 19: 24,921,141 S318P probably damaging Het
Ccdc144b T A 3: 36,025,937 T224S probably benign Het
Ccdc150 C T 1: 54,304,898 T530I probably benign Het
Chd6 G A 2: 160,961,279 Q2160* probably null Het
Cluap1 T A 16: 3,919,500 I172N possibly damaging Het
Cnot2 T C 10: 116,498,373 N329S probably benign Het
Cog4 A T 8: 110,882,202 T175S unknown Het
Coq7 C A 7: 118,529,674 R46L probably benign Het
D630045J12Rik A T 6: 38,168,263 V1276E probably damaging Het
Dcaf15 A G 8: 84,102,765 V116A possibly damaging Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Defa25 G A 8: 21,085,200 C65Y probably damaging Het
Dhx38 T C 8: 109,558,927 T425A probably benign Het
Diaph1 T C 18: 37,889,776 T782A probably benign Het
Dnah7b T A 1: 46,142,085 M1044K possibly damaging Het
Dusp16 G A 6: 134,718,977 T297M probably benign Het
Esyt2 A G 12: 116,342,238 N363D probably damaging Het
Fasl C T 1: 161,788,191 C32Y possibly damaging Het
Flg T C 3: 93,281,734 V137A probably benign Het
Gpr150 G A 13: 76,056,007 A273V probably benign Het
Grk5 A G 19: 60,890,607 T10A probably benign Het
Hivep2 A G 10: 14,131,165 K1169R possibly damaging Het
Ido2 A C 8: 24,540,641 Y224* probably null Het
Ido2 A G 8: 24,548,823 I149T probably damaging Het
Kctd2 A G 11: 115,422,019 T126A possibly damaging Het
Kif1a T C 1: 93,041,583 D1090G probably benign Het
Klrb1a A T 6: 128,609,734 H222Q possibly damaging Het
Kndc1 A C 7: 139,920,783 H688P probably damaging Het
Malrd1 A G 2: 16,101,911 I1845V unknown Het
Mob3c G A 4: 115,831,684 R138H probably benign Het
Mre11a T A 9: 14,811,913 D394E possibly damaging Het
Myh7b A T 2: 155,622,186 I536F probably damaging Het
Nacad T A 11: 6,598,589 K1382* probably null Het
Ncor1 T C 11: 62,384,772 K128R possibly damaging Het
Olfr1349 T C 7: 6,514,521 N303D probably damaging Het
Ostn T A 16: 27,346,969 probably null Het
Pacs1 G A 19: 5,138,975 T793I probably damaging Het
Pcdhb2 T C 18: 37,296,494 S507P probably damaging Het
Pde2a A G 7: 101,503,390 K393E possibly damaging Het
Pfkl T A 10: 77,989,589 N656Y probably damaging Het
Phf20 T A 2: 156,293,411 probably null Het
Plekha6 G T 1: 133,275,848 E550* probably null Het
Plxna4 A T 6: 32,162,160 V1691E probably damaging Het
Rag1 A T 2: 101,641,778 H1006Q probably damaging Het
Rfx4 C T 10: 84,905,055 P679L probably benign Het
Ripor2 A G 13: 24,694,145 H301R probably damaging Het
Rrp12 A T 19: 41,883,438 I469N possibly damaging Het
Serpinb6b A G 13: 32,977,576 T211A probably benign Het
Sf1 A T 19: 6,376,353 H547L unknown Het
Slc29a1 T C 17: 45,592,182 D9G probably damaging Het
Sptan1 T A 2: 30,002,299 M1075K probably benign Het
Syngap1 A G 17: 26,957,767 D474G probably damaging Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Timeless A G 10: 128,252,001 T1148A probably benign Het
Tmem116 A T 5: 121,463,836 probably null Het
Tmem158 A T 9: 123,260,325 I74N probably damaging Het
Traf5 T A 1: 192,059,017 D174V probably benign Het
Trim65 A T 11: 116,127,708 I247N probably benign Het
Tsfm A T 10: 127,011,631 V197E probably benign Het
Utrn A G 10: 12,728,818 C539R possibly damaging Het
Vps13a A T 19: 16,678,042 F1874Y probably benign Het
Wdr6 A G 9: 108,576,039 M215T possibly damaging Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h7b A G 15: 81,771,787 D112G possibly damaging Het
Zc3hav1 C T 6: 38,353,976 D83N probably benign Het
Zfp369 T A 13: 65,296,117 V358E probably damaging Het
Zfp946 T A 17: 22,453,508 C29* probably null Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103221324 missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103214519 missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103214946 missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103200571 missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103200601 missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103215954 missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103215817 missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103215194 nonsense probably null
R8131:Lrriq1 UTSW 10 103215711 missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 103156335 critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103170547 missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103234068 missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103215053 missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 103046155 missense
R9013:Lrriq1 UTSW 10 103215070 missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103216003 missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103214779 missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103221283 missense probably benign
R9384:Lrriq1 UTSW 10 103170597 missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103215389 missense probably benign
R9706:Lrriq1 UTSW 10 103046041 missense
R9780:Lrriq1 UTSW 10 103189963 missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202359 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202360 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103234085 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTGTCTTTTCTATGTATTCTGGAA -3'
(R):5'- CATCAGGGGCAAGGGACATT -3'

Sequencing Primer
(F):5'- CACACTTCAATACATCGTGT -3'
(R):5'- GGGACATTTTGAAGGGATAATTAAGC -3'
Posted On 2019-06-26