Incidental Mutation 'R0579:Abcf3'
ID56370
Institutional Source Beutler Lab
Gene Symbol Abcf3
Ensembl Gene ENSMUSG00000003234
Gene NameATP-binding cassette, sub-family F (GCN20), member 3
Synonyms
MMRRC Submission 038769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0579 (G1)
Quality Score173
Status Validated
Chromosome16
Chromosomal Location20548577-20561379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20550648 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 260 (R260Q)
Ref Sequence ENSEMBL: ENSMUSP00000156048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003319] [ENSMUST00000232490] [ENSMUST00000232680]
Predicted Effect probably benign
Transcript: ENSMUST00000003319
AA Change: R266Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003319
Gene: ENSMUSG00000003234
AA Change: R266Q

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
AAA 202 401 3.23e-11 SMART
low complexity region 423 435 N/A INTRINSIC
low complexity region 457 469 N/A INTRINSIC
AAA 517 684 4.68e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154660
Predicted Effect probably benign
Transcript: ENSMUST00000231258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232127
Predicted Effect probably benign
Transcript: ENSMUST00000232490
Predicted Effect probably benign
Transcript: ENSMUST00000232680
AA Change: R260Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Abcg3 A G 5: 104,974,103 V136A probably damaging Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Ambra1 A G 2: 91,824,465 N783S possibly damaging Het
Cd300ld2 A G 11: 115,012,299 F240S probably benign Het
Cep83 A G 10: 94,749,053 D340G possibly damaging Het
Crybg2 T A 4: 134,072,738 I403N probably damaging Het
Dnah14 T A 1: 181,744,747 M2881K possibly damaging Het
Erbb4 T C 1: 68,042,462 M1138V probably benign Het
Evi5 A G 5: 107,821,709 V112A probably benign Het
F2r A G 13: 95,618,349 V9A probably benign Het
Flot1 C A 17: 35,831,008 S337R probably benign Het
Glt28d2 G A 3: 85,872,133 T11I probably damaging Het
Gm19345 A G 7: 19,854,976 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Hmgcs2 A T 3: 98,290,948 I56F probably damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Il21 T G 3: 37,227,774 K74Q possibly damaging Het
Itpripl1 G T 2: 127,141,091 Y370* probably null Het
Kif24 G A 4: 41,393,706 P1056S probably damaging Het
L2hgdh A T 12: 69,701,272 probably benign Het
Lipo2 A T 19: 33,746,898 L156Q probably damaging Het
Nlrp4c T A 7: 6,060,845 M84K probably benign Het
Npy4r G A 14: 34,146,683 T216I probably benign Het
Olfr109 T C 17: 37,466,347 V47A probably benign Het
Olfr802 A T 10: 129,682,237 C167* probably null Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pafah1b2 T C 9: 45,968,713 E222G probably benign Het
Pop1 T A 15: 34,509,969 D406E possibly damaging Het
Proser1 A G 3: 53,467,151 Y32C probably damaging Het
Ptprj C A 2: 90,436,569 probably null Het
Slc1a3 T A 15: 8,688,309 I100F probably damaging Het
Slc25a22 T C 7: 141,431,359 D176G probably damaging Het
Stard7 T C 2: 127,284,553 V99A probably damaging Het
Stk33 C T 7: 109,325,697 V184I probably damaging Het
Timmdc1 A G 16: 38,522,383 L51P probably benign Het
Tppp T C 13: 74,021,233 S31P probably benign Het
Upf2 A T 2: 5,988,429 R599W unknown Het
Vav1 G T 17: 57,279,271 W25L probably benign Het
Other mutations in Abcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Abcf3 APN 16 20551684 missense probably damaging 0.98
IGL01570:Abcf3 APN 16 20559998 missense probably damaging 1.00
IGL02239:Abcf3 APN 16 20550636 missense possibly damaging 0.85
R0158:Abcf3 UTSW 16 20552566 missense probably damaging 1.00
R0270:Abcf3 UTSW 16 20560168 splice site probably null
R0671:Abcf3 UTSW 16 20550487 missense probably damaging 1.00
R0799:Abcf3 UTSW 16 20559334 missense probably damaging 1.00
R1384:Abcf3 UTSW 16 20559303 missense probably damaging 1.00
R1393:Abcf3 UTSW 16 20560430 missense probably benign 0.01
R2356:Abcf3 UTSW 16 20560499 missense probably benign 0.01
R2910:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R2911:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R3081:Abcf3 UTSW 16 20559364 missense probably benign 0.09
R3852:Abcf3 UTSW 16 20560439 missense probably damaging 1.00
R4707:Abcf3 UTSW 16 20549058 missense possibly damaging 0.91
R4752:Abcf3 UTSW 16 20550576 missense probably damaging 1.00
R4885:Abcf3 UTSW 16 20551675 missense probably benign 0.05
R5672:Abcf3 UTSW 16 20549252 missense probably benign 0.00
R5817:Abcf3 UTSW 16 20549083 missense possibly damaging 0.95
R6013:Abcf3 UTSW 16 20550561 unclassified probably null
R6019:Abcf3 UTSW 16 20552451 missense possibly damaging 0.60
R6026:Abcf3 UTSW 16 20550570 missense probably damaging 1.00
R6952:Abcf3 UTSW 16 20549734 splice site probably null
R7327:Abcf3 UTSW 16 20548680 missense probably benign 0.03
R7431:Abcf3 UTSW 16 20558789 missense probably benign 0.00
R7539:Abcf3 UTSW 16 20552632 critical splice donor site probably null
R7764:Abcf3 UTSW 16 20549290 missense probably benign 0.36
X0066:Abcf3 UTSW 16 20559697 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTGGGGAAGACGACATTGCTAAAGAT -3'
(R):5'- TTCTGCGGCTCACGAGGGA -3'

Sequencing Primer
(F):5'- TGCTAAAGATGCTGGCTACC -3'
(R):5'- gcctgctcgcttactgaac -3'
Posted On2013-07-11