Incidental Mutation 'R7248:Ripor2'
ID563707
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R7248 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24694145 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 301 (H301R)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect probably damaging
Transcript: ENSMUST00000038477
AA Change: H301R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: H301R

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058009
AA Change: H301R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: H301R

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091694
AA Change: H304R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: H304R

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: H276R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: H276R

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: H301R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: H301R

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Meta Mutation Damage Score 0.8015 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,310 probably null Het
2810403A07Rik T C 3: 88,693,579 S228P probably damaging Het
4931409K22Rik C T 5: 24,544,271 S743N probably benign Het
Aldh16a1 A G 7: 45,145,594 Y484H probably damaging Het
Arhgap26 T C 18: 39,306,854 probably null Het
Atxn7l1 A G 12: 33,367,195 T452A probably benign Het
Baz1a C T 12: 54,900,508 E1119K probably damaging Het
Btaf1 A T 19: 36,945,314 E39D possibly damaging Het
Bud13 G T 9: 46,283,115 E29* probably null Het
Cbwd1 A G 19: 24,921,141 S318P probably damaging Het
Ccdc144b T A 3: 36,025,937 T224S probably benign Het
Ccdc150 C T 1: 54,304,898 T530I probably benign Het
Chd6 G A 2: 160,961,279 Q2160* probably null Het
Cluap1 T A 16: 3,919,500 I172N possibly damaging Het
Cnot2 T C 10: 116,498,373 N329S probably benign Het
Cog4 A T 8: 110,882,202 T175S unknown Het
Coq7 C A 7: 118,529,674 R46L probably benign Het
D630045J12Rik A T 6: 38,168,263 V1276E probably damaging Het
Dcaf15 A G 8: 84,102,765 V116A possibly damaging Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Defa25 G A 8: 21,085,200 C65Y probably damaging Het
Dhx38 T C 8: 109,558,927 T425A probably benign Het
Diaph1 T C 18: 37,889,776 T782A probably benign Het
Dnah7b T A 1: 46,142,085 M1044K possibly damaging Het
Dusp16 G A 6: 134,718,977 T297M probably benign Het
Esyt2 A G 12: 116,342,238 N363D probably damaging Het
Fasl C T 1: 161,788,191 C32Y possibly damaging Het
Flg T C 3: 93,281,734 V137A probably benign Het
Gpr150 G A 13: 76,056,007 A273V probably benign Het
Grk5 A G 19: 60,890,607 T10A probably benign Het
Hivep2 A G 10: 14,131,165 K1169R possibly damaging Het
Ido2 A C 8: 24,540,641 Y224* probably null Het
Ido2 A G 8: 24,548,823 I149T probably damaging Het
Kctd2 A G 11: 115,422,019 T126A possibly damaging Het
Kif1a T C 1: 93,041,583 D1090G probably benign Het
Klrb1a A T 6: 128,609,734 H222Q possibly damaging Het
Kndc1 A C 7: 139,920,783 H688P probably damaging Het
Lrriq1 C A 10: 103,223,750 V141F possibly damaging Het
Malrd1 A G 2: 16,101,911 I1845V unknown Het
Mob3c G A 4: 115,831,684 R138H probably benign Het
Mre11a T A 9: 14,811,913 D394E possibly damaging Het
Myh7b A T 2: 155,622,186 I536F probably damaging Het
Nacad T A 11: 6,598,589 K1382* probably null Het
Ncor1 T C 11: 62,384,772 K128R possibly damaging Het
Olfr1349 T C 7: 6,514,521 N303D probably damaging Het
Ostn T A 16: 27,346,969 probably null Het
Pacs1 G A 19: 5,138,975 T793I probably damaging Het
Pcdhb2 T C 18: 37,296,494 S507P probably damaging Het
Pde2a A G 7: 101,503,390 K393E possibly damaging Het
Pfkl T A 10: 77,989,589 N656Y probably damaging Het
Phf20 T A 2: 156,293,411 probably null Het
Plekha6 G T 1: 133,275,848 E550* probably null Het
Plxna4 A T 6: 32,162,160 V1691E probably damaging Het
Rag1 A T 2: 101,641,778 H1006Q probably damaging Het
Rfx4 C T 10: 84,905,055 P679L probably benign Het
Rrp12 A T 19: 41,883,438 I469N possibly damaging Het
Serpinb6b A G 13: 32,977,576 T211A probably benign Het
Sf1 A T 19: 6,376,353 H547L unknown Het
Slc29a1 T C 17: 45,592,182 D9G probably damaging Het
Sptan1 T A 2: 30,002,299 M1075K probably benign Het
Syngap1 A G 17: 26,957,767 D474G probably damaging Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Timeless A G 10: 128,252,001 T1148A probably benign Het
Tmem116 A T 5: 121,463,836 probably null Het
Tmem158 A T 9: 123,260,325 I74N probably damaging Het
Traf5 T A 1: 192,059,017 D174V probably benign Het
Trim65 A T 11: 116,127,708 I247N probably benign Het
Tsfm A T 10: 127,011,631 V197E probably benign Het
Utrn A G 10: 12,728,818 C539R possibly damaging Het
Vps13a A T 19: 16,678,042 F1874Y probably benign Het
Wdr6 A G 9: 108,576,039 M215T possibly damaging Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h7b A G 15: 81,771,787 D112G possibly damaging Het
Zc3hav1 C T 6: 38,353,976 D83N probably benign Het
Zfp369 T A 13: 65,296,117 V358E probably damaging Het
Zfp946 T A 17: 22,453,508 C29* probably null Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8157:Ripor2 UTSW 13 24695617 missense probably benign 0.05
R8364:Ripor2 UTSW 13 24710193 missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24723788 missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24665468 intron probably benign
R8751:Ripor2 UTSW 13 24701067 missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24717668 missense not run
Predicted Primers PCR Primer
(F):5'- TAGGTCTCTCTGTGTGCAAAG -3'
(R):5'- CAGTTCAGGTGTGACCACTG -3'

Sequencing Primer
(F):5'- GCAAAGCCTCTTTTAGTTGAGATGC -3'
(R):5'- TAGCCTGGAAGAACACTAGCCATG -3'
Posted On2019-06-26