Incidental Mutation 'R7248:Serpinb6b'
ID 563708
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R7248 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32977576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 211 (T211A)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110293
AA Change: T211A

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: T211A

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
AA Change: T92A

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,310 probably null Het
2810403A07Rik T C 3: 88,693,579 S228P probably damaging Het
4931409K22Rik C T 5: 24,544,271 S743N probably benign Het
Aldh16a1 A G 7: 45,145,594 Y484H probably damaging Het
Arhgap26 T C 18: 39,306,854 probably null Het
Atxn7l1 A G 12: 33,367,195 T452A probably benign Het
Baz1a C T 12: 54,900,508 E1119K probably damaging Het
Btaf1 A T 19: 36,945,314 E39D possibly damaging Het
Bud13 G T 9: 46,283,115 E29* probably null Het
Cbwd1 A G 19: 24,921,141 S318P probably damaging Het
Ccdc144b T A 3: 36,025,937 T224S probably benign Het
Ccdc150 C T 1: 54,304,898 T530I probably benign Het
Chd6 G A 2: 160,961,279 Q2160* probably null Het
Cluap1 T A 16: 3,919,500 I172N possibly damaging Het
Cnot2 T C 10: 116,498,373 N329S probably benign Het
Cog4 A T 8: 110,882,202 T175S unknown Het
Coq7 C A 7: 118,529,674 R46L probably benign Het
D630045J12Rik A T 6: 38,168,263 V1276E probably damaging Het
Dcaf15 A G 8: 84,102,765 V116A possibly damaging Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Defa25 G A 8: 21,085,200 C65Y probably damaging Het
Dhx38 T C 8: 109,558,927 T425A probably benign Het
Diaph1 T C 18: 37,889,776 T782A probably benign Het
Dnah7b T A 1: 46,142,085 M1044K possibly damaging Het
Dusp16 G A 6: 134,718,977 T297M probably benign Het
Esyt2 A G 12: 116,342,238 N363D probably damaging Het
Fasl C T 1: 161,788,191 C32Y possibly damaging Het
Flg T C 3: 93,281,734 V137A probably benign Het
Gpr150 G A 13: 76,056,007 A273V probably benign Het
Grk5 A G 19: 60,890,607 T10A probably benign Het
Hivep2 A G 10: 14,131,165 K1169R possibly damaging Het
Ido2 A C 8: 24,540,641 Y224* probably null Het
Ido2 A G 8: 24,548,823 I149T probably damaging Het
Kctd2 A G 11: 115,422,019 T126A possibly damaging Het
Kif1a T C 1: 93,041,583 D1090G probably benign Het
Klrb1a A T 6: 128,609,734 H222Q possibly damaging Het
Kndc1 A C 7: 139,920,783 H688P probably damaging Het
Lrriq1 C A 10: 103,223,750 V141F possibly damaging Het
Malrd1 A G 2: 16,101,911 I1845V unknown Het
Mob3c G A 4: 115,831,684 R138H probably benign Het
Mre11a T A 9: 14,811,913 D394E possibly damaging Het
Myh7b A T 2: 155,622,186 I536F probably damaging Het
Nacad T A 11: 6,598,589 K1382* probably null Het
Ncor1 T C 11: 62,384,772 K128R possibly damaging Het
Olfr1349 T C 7: 6,514,521 N303D probably damaging Het
Ostn T A 16: 27,346,969 probably null Het
Pacs1 G A 19: 5,138,975 T793I probably damaging Het
Pcdhb2 T C 18: 37,296,494 S507P probably damaging Het
Pde2a A G 7: 101,503,390 K393E possibly damaging Het
Pfkl T A 10: 77,989,589 N656Y probably damaging Het
Phf20 T A 2: 156,293,411 probably null Het
Plekha6 G T 1: 133,275,848 E550* probably null Het
Plxna4 A T 6: 32,162,160 V1691E probably damaging Het
Rag1 A T 2: 101,641,778 H1006Q probably damaging Het
Rfx4 C T 10: 84,905,055 P679L probably benign Het
Ripor2 A G 13: 24,694,145 H301R probably damaging Het
Rrp12 A T 19: 41,883,438 I469N possibly damaging Het
Sf1 A T 19: 6,376,353 H547L unknown Het
Slc29a1 T C 17: 45,592,182 D9G probably damaging Het
Sptan1 T A 2: 30,002,299 M1075K probably benign Het
Syngap1 A G 17: 26,957,767 D474G probably damaging Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Timeless A G 10: 128,252,001 T1148A probably benign Het
Tmem116 A T 5: 121,463,836 probably null Het
Tmem158 A T 9: 123,260,325 I74N probably damaging Het
Traf5 T A 1: 192,059,017 D174V probably benign Het
Trim65 A T 11: 116,127,708 I247N probably benign Het
Tsfm A T 10: 127,011,631 V197E probably benign Het
Utrn A G 10: 12,728,818 C539R possibly damaging Het
Vps13a A T 19: 16,678,042 F1874Y probably benign Het
Wdr6 A G 9: 108,576,039 M215T possibly damaging Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h7b A G 15: 81,771,787 D112G possibly damaging Het
Zc3hav1 C T 6: 38,353,976 D83N probably benign Het
Zfp369 T A 13: 65,296,117 V358E probably damaging Het
Zfp946 T A 17: 22,453,508 C29* probably null Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- TCCAGAGGTTGAGGGACTG -3'
(R):5'- TTCAGGCTCTGGGTTCCAC -3'

Sequencing Primer
(F):5'- TTGAGGGACTGAGGGAATGATCAATC -3'
(R):5'- CGTGATCATGGGAGCCTAG -3'
Posted On 2019-06-26