Incidental Mutation 'R7248:Serpinb6b'
ID 563708
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
MMRRC Submission 045311-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7248 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 33149192-33163050 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33161559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 211 (T211A)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110293
AA Change: T211A

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: T211A

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
AA Change: T92A

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,207,959 (GRCm39) probably null Het
Aldh16a1 A G 7: 44,795,018 (GRCm39) Y484H probably damaging Het
Arhgap26 T C 18: 39,439,907 (GRCm39) probably null Het
Atxn7l1 A G 12: 33,417,194 (GRCm39) T452A probably benign Het
Baz1a C T 12: 54,947,293 (GRCm39) E1119K probably damaging Het
Btaf1 A T 19: 36,922,714 (GRCm39) E39D possibly damaging Het
Bud13 G T 9: 46,194,413 (GRCm39) E29* probably null Het
Ccdc150 C T 1: 54,344,057 (GRCm39) T530I probably benign Het
Chd6 G A 2: 160,803,199 (GRCm39) Q2160* probably null Het
Cluap1 T A 16: 3,737,364 (GRCm39) I172N possibly damaging Het
Cnot2 T C 10: 116,334,278 (GRCm39) N329S probably benign Het
Cog4 A T 8: 111,608,834 (GRCm39) T175S unknown Het
Coq7 C A 7: 118,128,897 (GRCm39) R46L probably benign Het
D630045J12Rik A T 6: 38,145,198 (GRCm39) V1276E probably damaging Het
Dcaf15 A G 8: 84,829,394 (GRCm39) V116A possibly damaging Het
Ddr2 C T 1: 169,822,198 (GRCm39) V417I probably benign Het
Defa25 G A 8: 21,575,216 (GRCm39) C65Y probably damaging Het
Dhx38 T C 8: 110,285,559 (GRCm39) T425A probably benign Het
Diaph1 T C 18: 38,022,829 (GRCm39) T782A probably benign Het
Dnah7b T A 1: 46,181,245 (GRCm39) M1044K possibly damaging Het
Dusp16 G A 6: 134,695,940 (GRCm39) T297M probably benign Het
Esyt2 A G 12: 116,305,858 (GRCm39) N363D probably damaging Het
Fasl C T 1: 161,615,760 (GRCm39) C32Y possibly damaging Het
Flg T C 3: 93,189,041 (GRCm39) V137A probably benign Het
Gm57858 T A 3: 36,080,086 (GRCm39) T224S probably benign Het
Gpr150 G A 13: 76,204,126 (GRCm39) A273V probably benign Het
Grk5 A G 19: 60,879,045 (GRCm39) T10A probably benign Het
Hivep2 A G 10: 14,006,909 (GRCm39) K1169R possibly damaging Het
Ido2 A C 8: 25,030,657 (GRCm39) Y224* probably null Het
Ido2 A G 8: 25,038,839 (GRCm39) I149T probably damaging Het
Iqca1l C T 5: 24,749,269 (GRCm39) S743N probably benign Het
Kctd2 A G 11: 115,312,845 (GRCm39) T126A possibly damaging Het
Khdc4 T C 3: 88,600,886 (GRCm39) S228P probably damaging Het
Kif1a T C 1: 92,969,305 (GRCm39) D1090G probably benign Het
Klrb1a A T 6: 128,586,697 (GRCm39) H222Q possibly damaging Het
Kndc1 A C 7: 139,500,699 (GRCm39) H688P probably damaging Het
Lrriq1 C A 10: 103,059,611 (GRCm39) V141F possibly damaging Het
Malrd1 A G 2: 16,106,722 (GRCm39) I1845V unknown Het
Mob3c G A 4: 115,688,881 (GRCm39) R138H probably benign Het
Mre11a T A 9: 14,723,209 (GRCm39) D394E possibly damaging Het
Myh7b A T 2: 155,464,106 (GRCm39) I536F probably damaging Het
Nacad T A 11: 6,548,589 (GRCm39) K1382* probably null Het
Ncor1 T C 11: 62,275,598 (GRCm39) K128R possibly damaging Het
Or10am5 T C 7: 6,517,520 (GRCm39) N303D probably damaging Het
Ostn T A 16: 27,165,719 (GRCm39) probably null Het
Pacs1 G A 19: 5,189,003 (GRCm39) T793I probably damaging Het
Pcdhb2 T C 18: 37,429,547 (GRCm39) S507P probably damaging Het
Pde2a A G 7: 101,152,597 (GRCm39) K393E possibly damaging Het
Pfkl T A 10: 77,825,423 (GRCm39) N656Y probably damaging Het
Phf20 T A 2: 156,135,331 (GRCm39) probably null Het
Plekha6 G T 1: 133,203,586 (GRCm39) E550* probably null Het
Plxna4 A T 6: 32,139,095 (GRCm39) V1691E probably damaging Het
Rag1 A T 2: 101,472,123 (GRCm39) H1006Q probably damaging Het
Rfx4 C T 10: 84,740,919 (GRCm39) P679L probably benign Het
Ripor2 A G 13: 24,878,128 (GRCm39) H301R probably damaging Het
Rrp12 A T 19: 41,871,877 (GRCm39) I469N possibly damaging Het
Sf1 A T 19: 6,426,383 (GRCm39) H547L unknown Het
Slc29a1 T C 17: 45,903,108 (GRCm39) D9G probably damaging Het
Sptan1 T A 2: 29,892,311 (GRCm39) M1075K probably benign Het
Syngap1 A G 17: 27,176,741 (GRCm39) D474G probably damaging Het
Syt16 C T 12: 74,313,483 (GRCm39) R470C probably damaging Het
Timeless A G 10: 128,087,870 (GRCm39) T1148A probably benign Het
Tmem116 A T 5: 121,601,899 (GRCm39) probably null Het
Tmem158 A T 9: 123,089,390 (GRCm39) I74N probably damaging Het
Traf5 T A 1: 191,743,432 (GRCm39) D174V probably benign Het
Trim65 A T 11: 116,018,534 (GRCm39) I247N probably benign Het
Tsfm A T 10: 126,847,500 (GRCm39) V197E probably benign Het
Utrn A G 10: 12,604,562 (GRCm39) C539R possibly damaging Het
Vps13a A T 19: 16,655,406 (GRCm39) F1874Y probably benign Het
Wdr6 A G 9: 108,453,238 (GRCm39) M215T possibly damaging Het
Wdr75 T A 1: 45,856,560 (GRCm39) W528R probably damaging Het
Zc3h7b A G 15: 81,655,988 (GRCm39) D112G possibly damaging Het
Zc3hav1 C T 6: 38,330,911 (GRCm39) D83N probably benign Het
Zfp369 T A 13: 65,443,931 (GRCm39) V358E probably damaging Het
Zfp946 T A 17: 22,672,489 (GRCm39) C29* probably null Het
Zng1 A G 19: 24,898,505 (GRCm39) S318P probably damaging Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 33,155,529 (GRCm39) missense probably benign 0.01
IGL01077:Serpinb6b APN 13 33,162,049 (GRCm39) missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 33,158,931 (GRCm39) missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 33,155,589 (GRCm39) missense probably benign 0.34
R0308:Serpinb6b UTSW 13 33,162,220 (GRCm39) missense probably benign 0.09
R1568:Serpinb6b UTSW 13 33,158,895 (GRCm39) missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 33,158,978 (GRCm39) missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 33,162,041 (GRCm39) missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 33,162,223 (GRCm39) missense probably benign
R1918:Serpinb6b UTSW 13 33,162,223 (GRCm39) missense probably benign
R1919:Serpinb6b UTSW 13 33,162,223 (GRCm39) missense probably benign
R1920:Serpinb6b UTSW 13 33,158,991 (GRCm39) missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 33,152,551 (GRCm39) missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 33,156,246 (GRCm39) missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 33,162,133 (GRCm39) missense probably benign
R5503:Serpinb6b UTSW 13 33,161,642 (GRCm39) missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 33,161,541 (GRCm39) nonsense probably null
R6061:Serpinb6b UTSW 13 33,161,977 (GRCm39) missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 33,156,255 (GRCm39) missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 33,155,598 (GRCm39) missense probably benign 0.09
R7315:Serpinb6b UTSW 13 33,156,240 (GRCm39) missense probably benign 0.41
R7424:Serpinb6b UTSW 13 33,152,650 (GRCm39) missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 33,158,907 (GRCm39) missense probably benign 0.05
R7732:Serpinb6b UTSW 13 33,152,590 (GRCm39) missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 33,161,512 (GRCm39) missense probably benign 0.05
R7802:Serpinb6b UTSW 13 33,155,579 (GRCm39)
R8814:Serpinb6b UTSW 13 33,162,287 (GRCm39) missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 33,162,035 (GRCm39) missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 33,162,125 (GRCm39) missense probably benign 0.45
R9037:Serpinb6b UTSW 13 33,161,998 (GRCm39) nonsense probably null
R9129:Serpinb6b UTSW 13 33,162,139 (GRCm39) small deletion probably benign
R9377:Serpinb6b UTSW 13 33,152,494 (GRCm39) start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 33,159,002 (GRCm39) missense
R9632:Serpinb6b UTSW 13 33,155,532 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCAGAGGTTGAGGGACTG -3'
(R):5'- TTCAGGCTCTGGGTTCCAC -3'

Sequencing Primer
(F):5'- TTGAGGGACTGAGGGAATGATCAATC -3'
(R):5'- CGTGATCATGGGAGCCTAG -3'
Posted On 2019-06-26