Incidental Mutation 'R0579:Timmdc1'
ID56371
Institutional Source Beutler Lab
Gene Symbol Timmdc1
Ensembl Gene ENSMUSG00000002846
Gene Nametranslocase of inner mitochondrial membrane domain containing 1
Synonyms
MMRRC Submission 038769-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0579 (G1)
Quality Score223
Status Not validated
Chromosome16
Chromosomal Location38498347-38522663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38522383 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 51 (L51P)
Ref Sequence ENSEMBL: ENSMUSP00000002925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002925] [ENSMUST00000036210]
Predicted Effect probably benign
Transcript: ENSMUST00000002925
AA Change: L51P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002925
Gene: ENSMUSG00000002846
AA Change: L51P

DomainStartEndE-ValueType
Pfam:Tim17 74 207 4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036210
SMART Domains Protein: ENSMUSP00000038166
Gene: ENSMUSG00000034064

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CAP10 121 373 6.69e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153187
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit lethality. Heterozygous mice show an increased mean percentage of CD4 cells in the peripheral blood compared with controls, but no other notable heterozygous phenotype was detected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Abcf3 G A 16: 20,550,648 R260Q probably benign Het
Abcg3 A G 5: 104,974,103 V136A probably damaging Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Ambra1 A G 2: 91,824,465 N783S possibly damaging Het
Cd300ld2 A G 11: 115,012,299 F240S probably benign Het
Cep83 A G 10: 94,749,053 D340G possibly damaging Het
Crybg2 T A 4: 134,072,738 I403N probably damaging Het
Dnah14 T A 1: 181,744,747 M2881K possibly damaging Het
Erbb4 T C 1: 68,042,462 M1138V probably benign Het
Evi5 A G 5: 107,821,709 V112A probably benign Het
F2r A G 13: 95,618,349 V9A probably benign Het
Flot1 C A 17: 35,831,008 S337R probably benign Het
Glt28d2 G A 3: 85,872,133 T11I probably damaging Het
Gm19345 A G 7: 19,854,976 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Hmgcs2 A T 3: 98,290,948 I56F probably damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Il21 T G 3: 37,227,774 K74Q possibly damaging Het
Itpripl1 G T 2: 127,141,091 Y370* probably null Het
Kif24 G A 4: 41,393,706 P1056S probably damaging Het
L2hgdh A T 12: 69,701,272 probably benign Het
Lipo2 A T 19: 33,746,898 L156Q probably damaging Het
Nlrp4c T A 7: 6,060,845 M84K probably benign Het
Npy4r G A 14: 34,146,683 T216I probably benign Het
Olfr109 T C 17: 37,466,347 V47A probably benign Het
Olfr802 A T 10: 129,682,237 C167* probably null Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pafah1b2 T C 9: 45,968,713 E222G probably benign Het
Pop1 T A 15: 34,509,969 D406E possibly damaging Het
Proser1 A G 3: 53,467,151 Y32C probably damaging Het
Ptprj C A 2: 90,436,569 probably null Het
Slc1a3 T A 15: 8,688,309 I100F probably damaging Het
Slc25a22 T C 7: 141,431,359 D176G probably damaging Het
Stard7 T C 2: 127,284,553 V99A probably damaging Het
Stk33 C T 7: 109,325,697 V184I probably damaging Het
Tppp T C 13: 74,021,233 S31P probably benign Het
Upf2 A T 2: 5,988,429 R599W unknown Het
Vav1 G T 17: 57,279,271 W25L probably benign Het
Other mutations in Timmdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Timmdc1 APN 16 38518385 missense probably benign 0.01
IGL01470:Timmdc1 APN 16 38518540 splice site probably benign
IGL02480:Timmdc1 APN 16 38522401 missense probably null 0.05
IGL03241:Timmdc1 APN 16 38510709 splice site probably benign
R0106:Timmdc1 UTSW 16 38522362 missense probably damaging 1.00
R1054:Timmdc1 UTSW 16 38522428 missense probably benign 0.00
R1661:Timmdc1 UTSW 16 38510717 critical splice donor site probably null
R1665:Timmdc1 UTSW 16 38510717 critical splice donor site probably null
R1793:Timmdc1 UTSW 16 38499057 missense possibly damaging 0.89
R2135:Timmdc1 UTSW 16 38498951 missense probably benign 0.01
R6234:Timmdc1 UTSW 16 38518499 nonsense probably null
R7472:Timmdc1 UTSW 16 38505418 nonsense probably null
R8169:Timmdc1 UTSW 16 38510786 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CATGTCAACCAGGTCGGACACTATC -3'
(R):5'- CAGTTCCAGTTTCTACGTCCCGAG -3'

Sequencing Primer
(F):5'- CACTATCCGGGCAGAGAGAAC -3'
(R):5'- AGGTTCAGTGTCCCCCAAC -3'
Posted On2013-07-11