Incidental Mutation 'R7248:Pacs1'
ID563720
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Namephosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7248 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5133688-5273119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5138975 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 793 (T793I)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: T793I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: T793I

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,310 probably null Het
2810403A07Rik T C 3: 88,693,579 S228P probably damaging Het
4931409K22Rik C T 5: 24,544,271 S743N probably benign Het
Aldh16a1 A G 7: 45,145,594 Y484H probably damaging Het
Arhgap26 T C 18: 39,306,854 probably null Het
Atxn7l1 A G 12: 33,367,195 T452A probably benign Het
Baz1a C T 12: 54,900,508 E1119K probably damaging Het
Btaf1 A T 19: 36,945,314 E39D possibly damaging Het
Bud13 G T 9: 46,283,115 E29* probably null Het
Cbwd1 A G 19: 24,921,141 S318P probably damaging Het
Ccdc144b T A 3: 36,025,937 T224S probably benign Het
Ccdc150 C T 1: 54,304,898 T530I probably benign Het
Chd6 G A 2: 160,961,279 Q2160* probably null Het
Cluap1 T A 16: 3,919,500 I172N possibly damaging Het
Cnot2 T C 10: 116,498,373 N329S probably benign Het
Cog4 A T 8: 110,882,202 T175S unknown Het
Coq7 C A 7: 118,529,674 R46L probably benign Het
D630045J12Rik A T 6: 38,168,263 V1276E probably damaging Het
Dcaf15 A G 8: 84,102,765 V116A possibly damaging Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Defa25 G A 8: 21,085,200 C65Y probably damaging Het
Dhx38 T C 8: 109,558,927 T425A probably benign Het
Diaph1 T C 18: 37,889,776 T782A probably benign Het
Dnah7b T A 1: 46,142,085 M1044K possibly damaging Het
Dusp16 G A 6: 134,718,977 T297M probably benign Het
Esyt2 A G 12: 116,342,238 N363D probably damaging Het
Fasl C T 1: 161,788,191 C32Y possibly damaging Het
Flg T C 3: 93,281,734 V137A probably benign Het
Gpr150 G A 13: 76,056,007 A273V probably benign Het
Grk5 A G 19: 60,890,607 T10A probably benign Het
Hivep2 A G 10: 14,131,165 K1169R possibly damaging Het
Ido2 A C 8: 24,540,641 Y224* probably null Het
Ido2 A G 8: 24,548,823 I149T probably damaging Het
Kctd2 A G 11: 115,422,019 T126A possibly damaging Het
Kif1a T C 1: 93,041,583 D1090G probably benign Het
Klrb1a A T 6: 128,609,734 H222Q possibly damaging Het
Kndc1 A C 7: 139,920,783 H688P probably damaging Het
Lrriq1 C A 10: 103,223,750 V141F possibly damaging Het
Malrd1 A G 2: 16,101,911 I1845V unknown Het
Mob3c G A 4: 115,831,684 R138H probably benign Het
Mre11a T A 9: 14,811,913 D394E possibly damaging Het
Myh7b A T 2: 155,622,186 I536F probably damaging Het
Nacad T A 11: 6,598,589 K1382* probably null Het
Ncor1 T C 11: 62,384,772 K128R possibly damaging Het
Olfr1349 T C 7: 6,514,521 N303D probably damaging Het
Ostn T A 16: 27,346,969 probably null Het
Pcdhb2 T C 18: 37,296,494 S507P probably damaging Het
Pde2a A G 7: 101,503,390 K393E possibly damaging Het
Pfkl T A 10: 77,989,589 N656Y probably damaging Het
Phf20 T A 2: 156,293,411 probably null Het
Plekha6 G T 1: 133,275,848 E550* probably null Het
Plxna4 A T 6: 32,162,160 V1691E probably damaging Het
Rag1 A T 2: 101,641,778 H1006Q probably damaging Het
Rfx4 C T 10: 84,905,055 P679L probably benign Het
Ripor2 A G 13: 24,694,145 H301R probably damaging Het
Rrp12 A T 19: 41,883,438 I469N possibly damaging Het
Serpinb6b A G 13: 32,977,576 T211A probably benign Het
Sf1 A T 19: 6,376,353 H547L unknown Het
Slc29a1 T C 17: 45,592,182 D9G probably damaging Het
Sptan1 T A 2: 30,002,299 M1075K probably benign Het
Syngap1 A G 17: 26,957,767 D474G probably damaging Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Timeless A G 10: 128,252,001 T1148A probably benign Het
Tmem116 A T 5: 121,463,836 probably null Het
Tmem158 A T 9: 123,260,325 I74N probably damaging Het
Traf5 T A 1: 192,059,017 D174V probably benign Het
Trim65 A T 11: 116,127,708 I247N probably benign Het
Tsfm A T 10: 127,011,631 V197E probably benign Het
Utrn A G 10: 12,728,818 C539R possibly damaging Het
Vps13a A T 19: 16,678,042 F1874Y probably benign Het
Wdr6 A G 9: 108,576,039 M215T possibly damaging Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h7b A G 15: 81,771,787 D112G possibly damaging Het
Zc3hav1 C T 6: 38,353,976 D83N probably benign Het
Zfp369 T A 13: 65,296,117 V358E probably damaging Het
Zfp946 T A 17: 22,453,508 C29* probably null Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AATGTCTCCGCCGCCTTATG -3'
(R):5'- ATTGGCTGCATGTGCTCACG -3'

Sequencing Primer
(F):5'- ATGACCCGTCTCTGGATTCCAC -3'
(R):5'- AAGGTCTGGGTCATTCCTCAGAG -3'
Posted On2019-06-26