Mutagenetix > Incidental Mutation

Incidental Mutation 'R7248:Grk5'

563726

Institutional Source

Beutler Lab

Gene Symbol

Grk5

Ensembl Gene

ENSMUSG00000003228

Gene Name

G protein-coupled receptor kinase 5

Synonyms

Gprk5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60889749-61092553 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60890607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 10 (T10A)

Ref Sequence

ENSEMBL: ENSMUSP00000003313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003313]

AlphaFold

Q8VEB1

Predicted Effect

probably benign
Transcript: ENSMUST00000003313
AA Change: T10A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000003313
Gene: ENSMUSG00000003228
AA Change: T10A

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
RGS	52	171	1.21e-35	SMART
S_TKc	186	448	9.44e-84	SMART
S_TK_X	449	528	1.08e-9	SMART
low complexity region	561	590	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a decrease in thermal pain sensation. Mice homozygous for a knock-out allele exhibit decreased response of heart to induced stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,414,310		probably null	Het
2810403A07Rik	T	C	3: 88,693,579	S228P	probably damaging	Het
4931409K22Rik	C	T	5: 24,544,271	S743N	probably benign	Het
Aldh16a1	A	G	7: 45,145,594	Y484H	probably damaging	Het
Arhgap26	T	C	18: 39,306,854		probably null	Het
Atxn7l1	A	G	12: 33,367,195	T452A	probably benign	Het
Baz1a	C	T	12: 54,900,508	E1119K	probably damaging	Het
Btaf1	A	T	19: 36,945,314	E39D	possibly damaging	Het
Bud13	G	T	9: 46,283,115	E29*	probably null	Het
Cbwd1	A	G	19: 24,921,141	S318P	probably damaging	Het
Ccdc144b	T	A	3: 36,025,937	T224S	probably benign	Het
Ccdc150	C	T	1: 54,304,898	T530I	probably benign	Het
Chd6	G	A	2: 160,961,279	Q2160*	probably null	Het
Cluap1	T	A	16: 3,919,500	I172N	possibly damaging	Het
Cnot2	T	C	10: 116,498,373	N329S	probably benign	Het
Cog4	A	T	8: 110,882,202	T175S	unknown	Het
Coq7	C	A	7: 118,529,674	R46L	probably benign	Het
D630045J12Rik	A	T	6: 38,168,263	V1276E	probably damaging	Het
Dcaf15	A	G	8: 84,102,765	V116A	possibly damaging	Het
Ddr2	C	T	1: 169,994,629	V417I	probably benign	Het
Defa25	G	A	8: 21,085,200	C65Y	probably damaging	Het
Dhx38	T	C	8: 109,558,927	T425A	probably benign	Het
Diaph1	T	C	18: 37,889,776	T782A	probably benign	Het
Dnah7b	T	A	1: 46,142,085	M1044K	possibly damaging	Het
Dusp16	G	A	6: 134,718,977	T297M	probably benign	Het
Esyt2	A	G	12: 116,342,238	N363D	probably damaging	Het
Fasl	C	T	1: 161,788,191	C32Y	possibly damaging	Het
Flg	T	C	3: 93,281,734	V137A	probably benign	Het
Gpr150	G	A	13: 76,056,007	A273V	probably benign	Het
Hivep2	A	G	10: 14,131,165	K1169R	possibly damaging	Het
Ido2	A	C	8: 24,540,641	Y224*	probably null	Het
Ido2	A	G	8: 24,548,823	I149T	probably damaging	Het
Kctd2	A	G	11: 115,422,019	T126A	possibly damaging	Het
Kif1a	T	C	1: 93,041,583	D1090G	probably benign	Het
Klrb1a	A	T	6: 128,609,734	H222Q	possibly damaging	Het
Kndc1	A	C	7: 139,920,783	H688P	probably damaging	Het
Lrriq1	C	A	10: 103,223,750	V141F	possibly damaging	Het
Malrd1	A	G	2: 16,101,911	I1845V	unknown	Het
Mob3c	G	A	4: 115,831,684	R138H	probably benign	Het
Mre11a	T	A	9: 14,811,913	D394E	possibly damaging	Het
Myh7b	A	T	2: 155,622,186	I536F	probably damaging	Het
Nacad	T	A	11: 6,598,589	K1382*	probably null	Het
Ncor1	T	C	11: 62,384,772	K128R	possibly damaging	Het
Olfr1349	T	C	7: 6,514,521	N303D	probably damaging	Het
Ostn	T	A	16: 27,346,969		probably null	Het
Pacs1	G	A	19: 5,138,975	T793I	probably damaging	Het
Pcdhb2	T	C	18: 37,296,494	S507P	probably damaging	Het
Pde2a	A	G	7: 101,503,390	K393E	possibly damaging	Het
Pfkl	T	A	10: 77,989,589	N656Y	probably damaging	Het
Phf20	T	A	2: 156,293,411		probably null	Het
Plekha6	G	T	1: 133,275,848	E550*	probably null	Het
Plxna4	A	T	6: 32,162,160	V1691E	probably damaging	Het
Rag1	A	T	2: 101,641,778	H1006Q	probably damaging	Het
Rfx4	C	T	10: 84,905,055	P679L	probably benign	Het
Ripor2	A	G	13: 24,694,145	H301R	probably damaging	Het
Rrp12	A	T	19: 41,883,438	I469N	possibly damaging	Het
Serpinb6b	A	G	13: 32,977,576	T211A	probably benign	Het
Sf1	A	T	19: 6,376,353	H547L	unknown	Het
Slc29a1	T	C	17: 45,592,182	D9G	probably damaging	Het
Sptan1	T	A	2: 30,002,299	M1075K	probably benign	Het
Syngap1	A	G	17: 26,957,767	D474G	probably damaging	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Timeless	A	G	10: 128,252,001	T1148A	probably benign	Het
Tmem116	A	T	5: 121,463,836		probably null	Het
Tmem158	A	T	9: 123,260,325	I74N	probably damaging	Het
Traf5	T	A	1: 192,059,017	D174V	probably benign	Het
Trim65	A	T	11: 116,127,708	I247N	probably benign	Het
Tsfm	A	T	10: 127,011,631	V197E	probably benign	Het
Utrn	A	G	10: 12,728,818	C539R	possibly damaging	Het
Vps13a	A	T	19: 16,678,042	F1874Y	probably benign	Het
Wdr6	A	G	9: 108,576,039	M215T	possibly damaging	Het
Wdr75	T	A	1: 45,817,400	W528R	probably damaging	Het
Zc3h7b	A	G	15: 81,771,787	D112G	possibly damaging	Het
Zc3hav1	C	T	6: 38,353,976	D83N	probably benign	Het
Zfp369	T	A	13: 65,296,117	V358E	probably damaging	Het
Zfp946	T	A	17: 22,453,508	C29*	probably null	Het

Other mutations in Grk5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02565:Grk5	APN	19	61069371	missense	probably damaging	0.99
IGL03183:Grk5	APN	19	61069336	missense	probably damaging	0.99
R0257:Grk5	UTSW	19	61076630	intron	probably benign
R1565:Grk5	UTSW	19	61089972	missense	probably damaging	0.99
R1603:Grk5	UTSW	19	61069362	missense	probably benign	0.06
R1672:Grk5	UTSW	19	61086215	splice site	probably null
R1687:Grk5	UTSW	19	61076783	missense	probably damaging	1.00
R1793:Grk5	UTSW	19	61076762	missense	probably damaging	1.00
R1822:Grk5	UTSW	19	61089972	missense	probably damaging	0.99
R1824:Grk5	UTSW	19	61089972	missense	probably damaging	0.99
R1876:Grk5	UTSW	19	61083225	missense	probably damaging	1.00
R4320:Grk5	UTSW	19	61091945	nonsense	probably null
R4828:Grk5	UTSW	19	60987775	nonsense	probably null
R5085:Grk5	UTSW	19	61076684	missense	probably damaging	1.00
R6237:Grk5	UTSW	19	61089942	missense	probably damaging	1.00
R6310:Grk5	UTSW	19	61080911	missense	probably damaging	0.96
R6736:Grk5	UTSW	19	60890626	missense	probably damaging	0.99
R7061:Grk5	UTSW	19	61046092	missense	probably benign	0.00
R7583:Grk5	UTSW	19	61083204	missense	possibly damaging	0.85
R7852:Grk5	UTSW	19	61080945	critical splice donor site	probably null
R8810:Grk5	UTSW	19	61089994	missense	possibly damaging	0.69
R9082:Grk5	UTSW	19	61046129	missense	possibly damaging	0.95
R9729:Grk5	UTSW	19	61090029	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CTCCGAGAAAGAATAATGCGGTAGC -3'
(R):5'- TTAACTCGTCCCTGCAACTG -3'

Sequencing Primer
(F):5'- CAGGCAGGCTGCTTGCTC -3'
(R):5'- GCCCAAGGCTCAGAAGTCTCTC -3'

Posted On

2019-06-26