Incidental Mutation 'R7248:Grk5'
ID563726
Institutional Source Beutler Lab
Gene Symbol Grk5
Ensembl Gene ENSMUSG00000003228
Gene NameG protein-coupled receptor kinase 5
SynonymsGprk5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7248 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location60889749-61092553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60890607 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000003313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003313]
Predicted Effect probably benign
Transcript: ENSMUST00000003313
AA Change: T10A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003313
Gene: ENSMUSG00000003228
AA Change: T10A

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
RGS 52 171 1.21e-35 SMART
S_TKc 186 448 9.44e-84 SMART
S_TK_X 449 528 1.08e-9 SMART
low complexity region 561 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a decrease in thermal pain sensation. Mice homozygous for a knock-out allele exhibit decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,310 probably null Het
2810403A07Rik T C 3: 88,693,579 S228P probably damaging Het
4931409K22Rik C T 5: 24,544,271 S743N probably benign Het
Aldh16a1 A G 7: 45,145,594 Y484H probably damaging Het
Arhgap26 T C 18: 39,306,854 probably null Het
Atxn7l1 A G 12: 33,367,195 T452A probably benign Het
Baz1a C T 12: 54,900,508 E1119K probably damaging Het
Btaf1 A T 19: 36,945,314 E39D possibly damaging Het
Bud13 G T 9: 46,283,115 E29* probably null Het
Cbwd1 A G 19: 24,921,141 S318P probably damaging Het
Ccdc144b T A 3: 36,025,937 T224S probably benign Het
Ccdc150 C T 1: 54,304,898 T530I probably benign Het
Chd6 G A 2: 160,961,279 Q2160* probably null Het
Cluap1 T A 16: 3,919,500 I172N possibly damaging Het
Cnot2 T C 10: 116,498,373 N329S probably benign Het
Cog4 A T 8: 110,882,202 T175S unknown Het
Coq7 C A 7: 118,529,674 R46L probably benign Het
D630045J12Rik A T 6: 38,168,263 V1276E probably damaging Het
Dcaf15 A G 8: 84,102,765 V116A possibly damaging Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Defa25 G A 8: 21,085,200 C65Y probably damaging Het
Dhx38 T C 8: 109,558,927 T425A probably benign Het
Diaph1 T C 18: 37,889,776 T782A probably benign Het
Dnah7b T A 1: 46,142,085 M1044K possibly damaging Het
Dusp16 G A 6: 134,718,977 T297M probably benign Het
Esyt2 A G 12: 116,342,238 N363D probably damaging Het
Fasl C T 1: 161,788,191 C32Y possibly damaging Het
Flg T C 3: 93,281,734 V137A probably benign Het
Gpr150 G A 13: 76,056,007 A273V probably benign Het
Hivep2 A G 10: 14,131,165 K1169R possibly damaging Het
Ido2 A C 8: 24,540,641 Y224* probably null Het
Ido2 A G 8: 24,548,823 I149T probably damaging Het
Kctd2 A G 11: 115,422,019 T126A possibly damaging Het
Kif1a T C 1: 93,041,583 D1090G probably benign Het
Klrb1a A T 6: 128,609,734 H222Q possibly damaging Het
Kndc1 A C 7: 139,920,783 H688P probably damaging Het
Lrriq1 C A 10: 103,223,750 V141F possibly damaging Het
Malrd1 A G 2: 16,101,911 I1845V unknown Het
Mob3c G A 4: 115,831,684 R138H probably benign Het
Mre11a T A 9: 14,811,913 D394E possibly damaging Het
Myh7b A T 2: 155,622,186 I536F probably damaging Het
Nacad T A 11: 6,598,589 K1382* probably null Het
Ncor1 T C 11: 62,384,772 K128R possibly damaging Het
Olfr1349 T C 7: 6,514,521 N303D probably damaging Het
Ostn T A 16: 27,346,969 probably null Het
Pacs1 G A 19: 5,138,975 T793I probably damaging Het
Pcdhb2 T C 18: 37,296,494 S507P probably damaging Het
Pde2a A G 7: 101,503,390 K393E possibly damaging Het
Pfkl T A 10: 77,989,589 N656Y probably damaging Het
Phf20 T A 2: 156,293,411 probably null Het
Plekha6 G T 1: 133,275,848 E550* probably null Het
Plxna4 A T 6: 32,162,160 V1691E probably damaging Het
Rag1 A T 2: 101,641,778 H1006Q probably damaging Het
Rfx4 C T 10: 84,905,055 P679L probably benign Het
Ripor2 A G 13: 24,694,145 H301R probably damaging Het
Rrp12 A T 19: 41,883,438 I469N possibly damaging Het
Serpinb6b A G 13: 32,977,576 T211A probably benign Het
Sf1 A T 19: 6,376,353 H547L unknown Het
Slc29a1 T C 17: 45,592,182 D9G probably damaging Het
Sptan1 T A 2: 30,002,299 M1075K probably benign Het
Syngap1 A G 17: 26,957,767 D474G probably damaging Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Timeless A G 10: 128,252,001 T1148A probably benign Het
Tmem116 A T 5: 121,463,836 probably null Het
Tmem158 A T 9: 123,260,325 I74N probably damaging Het
Traf5 T A 1: 192,059,017 D174V probably benign Het
Trim65 A T 11: 116,127,708 I247N probably benign Het
Tsfm A T 10: 127,011,631 V197E probably benign Het
Utrn A G 10: 12,728,818 C539R possibly damaging Het
Vps13a A T 19: 16,678,042 F1874Y probably benign Het
Wdr6 A G 9: 108,576,039 M215T possibly damaging Het
Wdr75 T A 1: 45,817,400 W528R probably damaging Het
Zc3h7b A G 15: 81,771,787 D112G possibly damaging Het
Zc3hav1 C T 6: 38,353,976 D83N probably benign Het
Zfp369 T A 13: 65,296,117 V358E probably damaging Het
Zfp946 T A 17: 22,453,508 C29* probably null Het
Other mutations in Grk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Grk5 APN 19 61069371 missense probably damaging 0.99
IGL03183:Grk5 APN 19 61069336 missense probably damaging 0.99
R0257:Grk5 UTSW 19 61076630 intron probably benign
R1565:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1603:Grk5 UTSW 19 61069362 missense probably benign 0.06
R1672:Grk5 UTSW 19 61086215 splice site probably null
R1687:Grk5 UTSW 19 61076783 missense probably damaging 1.00
R1793:Grk5 UTSW 19 61076762 missense probably damaging 1.00
R1822:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1824:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1876:Grk5 UTSW 19 61083225 missense probably damaging 1.00
R4320:Grk5 UTSW 19 61091945 nonsense probably null
R4828:Grk5 UTSW 19 60987775 nonsense probably null
R5085:Grk5 UTSW 19 61076684 missense probably damaging 1.00
R6237:Grk5 UTSW 19 61089942 missense probably damaging 1.00
R6310:Grk5 UTSW 19 61080911 missense probably damaging 0.96
R6736:Grk5 UTSW 19 60890626 missense probably damaging 0.99
R7061:Grk5 UTSW 19 61046092 missense probably benign 0.00
R7583:Grk5 UTSW 19 61083204 missense possibly damaging 0.85
R7852:Grk5 UTSW 19 61080945 critical splice donor site probably null
R8810:Grk5 UTSW 19 61089994 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTCCGAGAAAGAATAATGCGGTAGC -3'
(R):5'- TTAACTCGTCCCTGCAACTG -3'

Sequencing Primer
(F):5'- CAGGCAGGCTGCTTGCTC -3'
(R):5'- GCCCAAGGCTCAGAAGTCTCTC -3'
Posted On2019-06-26