Incidental Mutation 'R0579:Or2h2c'
ID 56373
Institutional Source Beutler Lab
Gene Symbol Or2h2c
Ensembl Gene ENSMUSG00000096477
Gene Name olfactory receptor family 2 subfamily H member 2C
Synonyms MOR256-29, Olfr92, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 038769-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R0579 (G1)
Quality Score 202
Status Validated
Chromosome 17
Chromosomal Location 37421934-37422872 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 37422347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 176 (L176V)
Ref Sequence ENSEMBL: ENSMUSP00000150988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
AlphaFold L7N475
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: L176V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174626
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,839,412 (GRCm39) probably null Het
Abcf3 G A 16: 20,369,398 (GRCm39) R260Q probably benign Het
Abcg3 A G 5: 105,121,969 (GRCm39) V136A probably damaging Het
Acr C G 15: 89,453,678 (GRCm39) H72Q probably damaging Het
Ambra1 A G 2: 91,654,810 (GRCm39) N783S possibly damaging Het
Cd300ld2 A G 11: 114,903,125 (GRCm39) F240S probably benign Het
Cep83 A G 10: 94,584,915 (GRCm39) D340G possibly damaging Het
Crybg2 T A 4: 133,800,049 (GRCm39) I403N probably damaging Het
Dnah14 T A 1: 181,572,312 (GRCm39) M2881K possibly damaging Het
Erbb4 T C 1: 68,081,621 (GRCm39) M1138V probably benign Het
Evi5 A G 5: 107,969,575 (GRCm39) V112A probably benign Het
F2r A G 13: 95,754,857 (GRCm39) V9A probably benign Het
Flot1 C A 17: 36,141,900 (GRCm39) S337R probably benign Het
Glt28d2 G A 3: 85,779,440 (GRCm39) T11I probably damaging Het
Gm19345 A G 7: 19,588,901 (GRCm39) probably benign Het
Gm6605 C A 7: 38,147,699 (GRCm39) noncoding transcript Het
Hmgcs2 A T 3: 98,198,264 (GRCm39) I56F probably damaging Het
Ifna9 T A 4: 88,510,508 (GRCm39) T39S possibly damaging Het
Il21 T G 3: 37,281,923 (GRCm39) K74Q possibly damaging Het
Itpripl1 G T 2: 126,983,011 (GRCm39) Y370* probably null Het
Kif24 G A 4: 41,393,706 (GRCm39) P1056S probably damaging Het
L2hgdh A T 12: 69,748,046 (GRCm39) probably benign Het
Lipo2 A T 19: 33,724,298 (GRCm39) L156Q probably damaging Het
Nlrp4c T A 7: 6,063,844 (GRCm39) M84K probably benign Het
Npy4r G A 14: 33,868,640 (GRCm39) T216I probably benign Het
Or12d17 T C 17: 37,777,238 (GRCm39) V47A probably benign Het
Or6c1 A T 10: 129,518,106 (GRCm39) C167* probably null Het
Pafah1b2 T C 9: 45,880,011 (GRCm39) E222G probably benign Het
Pop1 T A 15: 34,510,115 (GRCm39) D406E possibly damaging Het
Proser1 A G 3: 53,374,572 (GRCm39) Y32C probably damaging Het
Ptprj C A 2: 90,266,913 (GRCm39) probably null Het
Slc1a3 T A 15: 8,717,793 (GRCm39) I100F probably damaging Het
Slc25a22 T C 7: 141,011,272 (GRCm39) D176G probably damaging Het
Stard7 T C 2: 127,126,473 (GRCm39) V99A probably damaging Het
Stk33 C T 7: 108,924,904 (GRCm39) V184I probably damaging Het
Timmdc1 A G 16: 38,342,745 (GRCm39) L51P probably benign Het
Tppp T C 13: 74,169,352 (GRCm39) S31P probably benign Het
Upf2 A T 2: 5,993,240 (GRCm39) R599W unknown Het
Vav1 G T 17: 57,586,271 (GRCm39) W25L probably benign Het
Other mutations in Or2h2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Or2h2c APN 17 37,422,701 (GRCm39) missense probably damaging 1.00
IGL02850:Or2h2c APN 17 37,422,865 (GRCm39) missense probably benign 0.35
IGL03209:Or2h2c APN 17 37,422,413 (GRCm39) missense probably benign 0.04
R0580:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0582:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0615:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0669:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0674:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0675:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R2424:Or2h2c UTSW 17 37,422,408 (GRCm39) missense probably benign 0.02
R3714:Or2h2c UTSW 17 37,422,227 (GRCm39) missense probably damaging 1.00
R4393:Or2h2c UTSW 17 37,424,971 (GRCm39) intron probably benign
R5811:Or2h2c UTSW 17 37,422,649 (GRCm39) missense probably benign 0.00
R6615:Or2h2c UTSW 17 37,422,494 (GRCm39) missense probably damaging 1.00
R6853:Or2h2c UTSW 17 37,422,400 (GRCm39) missense probably benign 0.02
R6876:Or2h2c UTSW 17 37,422,098 (GRCm39) missense probably damaging 1.00
R7665:Or2h2c UTSW 17 37,422,283 (GRCm39) missense probably benign 0.20
R8087:Or2h2c UTSW 17 37,422,440 (GRCm39) missense probably benign
R9224:Or2h2c UTSW 17 37,422,767 (GRCm39) missense possibly damaging 0.53
R9439:Or2h2c UTSW 17 37,422,205 (GRCm39) missense probably damaging 1.00
R9541:Or2h2c UTSW 17 37,422,824 (GRCm39) missense probably benign 0.00
R9559:Or2h2c UTSW 17 37,422,509 (GRCm39) missense possibly damaging 0.84
Z1177:Or2h2c UTSW 17 37,422,322 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGAGCTTATCTTCAGCACTGCC -3'
(R):5'- GAAACACACTCATCCTCCTGCTGTC -3'

Sequencing Primer
(F):5'- CCTGGCAATGGCACCATAAG -3'
(R):5'- TCATGTCCCTGGGTACAACAG -3'
Posted On 2013-07-11