Incidental Mutation 'R0579:Olfr92'
ID 56373
Institutional Source Beutler Lab
Gene Symbol Olfr92
Ensembl Gene ENSMUSG00000096477
Gene Name olfactory receptor 92
Synonyms MOR256-29, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 038769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R0579 (G1)
Quality Score 202
Status Validated
Chromosome 17
Chromosomal Location 37110512-37120088 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 37111455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 176 (L176V)
Ref Sequence ENSEMBL: ENSMUSP00000150988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
AlphaFold L7N475
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: L176V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174626
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Abcf3 G A 16: 20,550,648 R260Q probably benign Het
Abcg3 A G 5: 104,974,103 V136A probably damaging Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Ambra1 A G 2: 91,824,465 N783S possibly damaging Het
Cd300ld2 A G 11: 115,012,299 F240S probably benign Het
Cep83 A G 10: 94,749,053 D340G possibly damaging Het
Crybg2 T A 4: 134,072,738 I403N probably damaging Het
Dnah14 T A 1: 181,744,747 M2881K possibly damaging Het
Erbb4 T C 1: 68,042,462 M1138V probably benign Het
Evi5 A G 5: 107,821,709 V112A probably benign Het
F2r A G 13: 95,618,349 V9A probably benign Het
Flot1 C A 17: 35,831,008 S337R probably benign Het
Glt28d2 G A 3: 85,872,133 T11I probably damaging Het
Gm19345 A G 7: 19,854,976 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Hmgcs2 A T 3: 98,290,948 I56F probably damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Il21 T G 3: 37,227,774 K74Q possibly damaging Het
Itpripl1 G T 2: 127,141,091 Y370* probably null Het
Kif24 G A 4: 41,393,706 P1056S probably damaging Het
L2hgdh A T 12: 69,701,272 probably benign Het
Lipo2 A T 19: 33,746,898 L156Q probably damaging Het
Nlrp4c T A 7: 6,060,845 M84K probably benign Het
Npy4r G A 14: 34,146,683 T216I probably benign Het
Olfr109 T C 17: 37,466,347 V47A probably benign Het
Olfr802 A T 10: 129,682,237 C167* probably null Het
Pafah1b2 T C 9: 45,968,713 E222G probably benign Het
Pop1 T A 15: 34,509,969 D406E possibly damaging Het
Proser1 A G 3: 53,467,151 Y32C probably damaging Het
Ptprj C A 2: 90,436,569 probably null Het
Slc1a3 T A 15: 8,688,309 I100F probably damaging Het
Slc25a22 T C 7: 141,431,359 D176G probably damaging Het
Stard7 T C 2: 127,284,553 V99A probably damaging Het
Stk33 C T 7: 109,325,697 V184I probably damaging Het
Timmdc1 A G 16: 38,522,383 L51P probably benign Het
Tppp T C 13: 74,021,233 S31P probably benign Het
Upf2 A T 2: 5,988,429 R599W unknown Het
Vav1 G T 17: 57,279,271 W25L probably benign Het
Other mutations in Olfr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr92 APN 17 37111809 missense probably damaging 1.00
IGL02850:Olfr92 APN 17 37111973 missense probably benign 0.35
IGL03209:Olfr92 APN 17 37111521 missense probably benign 0.04
R0580:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0582:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0615:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0669:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0674:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0675:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R2424:Olfr92 UTSW 17 37111516 missense probably benign 0.02
R3714:Olfr92 UTSW 17 37111335 missense probably damaging 1.00
R4393:Olfr92 UTSW 17 37114084 intron probably benign
R5811:Olfr92 UTSW 17 37111757 missense probably benign 0.00
R6615:Olfr92 UTSW 17 37111602 missense probably damaging 1.00
R6853:Olfr92 UTSW 17 37111508 missense probably benign 0.02
R6876:Olfr92 UTSW 17 37111206 missense probably damaging 1.00
R7665:Olfr92 UTSW 17 37111391 missense probably benign 0.20
R8087:Olfr92 UTSW 17 37111548 missense probably benign
R9224:Olfr92 UTSW 17 37111875 missense possibly damaging 0.53
R9439:Olfr92 UTSW 17 37111313 missense probably damaging 1.00
Z1177:Olfr92 UTSW 17 37111430 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGAGCTTATCTTCAGCACTGCC -3'
(R):5'- GAAACACACTCATCCTCCTGCTGTC -3'

Sequencing Primer
(F):5'- CCTGGCAATGGCACCATAAG -3'
(R):5'- TCATGTCCCTGGGTACAACAG -3'
Posted On 2013-07-11