Incidental Mutation 'R7249:Nelfcd'
ID563740
Institutional Source Beutler Lab
Gene Symbol Nelfcd
Ensembl Gene ENSMUSG00000016253
Gene Namenegative elongation factor complex member C/D, Th1l
Synonymstrihydrophobin 1, Th1l, 2410003I03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R7249 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location174415804-174427502 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 174423206 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect probably null
Transcript: ENSMUST00000016397
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109075
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,341 T38A probably benign Het
3425401B19Rik G T 14: 32,663,314 S231R possibly damaging Het
Abi1 T C 2: 22,957,089 E250G possibly damaging Het
Actl6b T A 5: 137,555,085 S120T probably damaging Het
Adgrv1 G A 13: 81,374,259 H5920Y probably damaging Het
Adra2c G A 5: 35,280,955 R357H probably damaging Het
Ap3d1 T C 10: 80,741,933 D20G probably damaging Het
Arfgef3 A T 10: 18,630,835 D847E possibly damaging Het
Cacna1d T C 14: 30,142,703 E434G probably damaging Het
Carm1 T C 9: 21,586,209 Y356H probably benign Het
Clip1 T C 5: 123,603,600 K1075R probably damaging Het
Cyp27b1 G T 10: 127,051,049 probably null Het
D630045J12Rik A T 6: 38,136,950 V1769D possibly damaging Het
Dchs2 C T 3: 83,128,029 Q28* probably null Het
Dpp4 A G 2: 62,385,203 F107L probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Faap24 A G 7: 35,395,060 V105A probably benign Het
Gabra6 A T 11: 42,317,432 D166E probably damaging Het
Gfpt1 A G 6: 87,056,144 E117G probably damaging Het
H2-T10 T C 17: 36,119,377 D224G probably damaging Het
Hspa12a T A 19: 58,805,433 E332V probably benign Het
Htr5b T A 1: 121,510,474 N343Y probably damaging Het
Irf8 C A 8: 120,739,832 N5K possibly damaging Het
Itgb1 C A 8: 128,720,404 Q467K probably benign Het
Itpr2 C A 6: 146,311,052 C1522F probably damaging Het
Jmjd1c T A 10: 67,189,817 L138I probably benign Het
Lrrc8b G T 5: 105,481,267 R493L probably benign Het
Malrd1 G T 2: 15,623,340 C400F probably damaging Het
March8 G A 6: 116,406,234 E257K probably benign Het
Mastl G A 2: 23,146,139 H122Y probably damaging Het
Mis18a T C 16: 90,726,314 K98R possibly damaging Het
Msra A G 14: 64,440,763 V28A probably benign Het
Mtmr7 A G 8: 40,590,477 V177A probably benign Het
Nemp1 T C 10: 127,693,526 S226P probably damaging Het
Nmnat1 G A 4: 149,469,642 T147I probably null Het
Ntng2 A G 2: 29,227,992 V148A probably benign Het
Nup214 A G 2: 31,988,233 H304R possibly damaging Het
Olfr1239 T C 2: 89,417,873 Y180C probably damaging Het
Phldb2 C A 16: 45,801,614 A623S probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkn3 G A 2: 30,084,761 R429Q probably benign Het
Plcb4 A G 2: 136,007,821 probably null Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnp G A 14: 50,951,430 V227I probably benign Het
Pskh1 T C 8: 105,913,254 S189P possibly damaging Het
Rbpms2 T G 9: 65,649,350 V24G probably damaging Het
Robo3 T A 9: 37,424,833 I446L probably benign Het
Sept8 A T 11: 53,535,122 K174I probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slco4a1 A G 2: 180,464,811 Y262C probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spidr T C 16: 15,966,648 S519G probably benign Het
Ssx2ip A G 3: 146,426,438 N218S possibly damaging Het
Svil T C 18: 5,056,270 V381A probably benign Het
Svil T C 18: 5,062,247 S769P probably damaging Het
Tep1 A T 14: 50,824,275 C2595S possibly damaging Het
Tiam1 T C 16: 89,843,255 Y858C probably damaging Het
Tie1 A G 4: 118,486,228 V146A probably benign Het
Traf3ip1 G T 1: 91,527,639 E578D probably damaging Het
Trim23 A G 13: 104,188,155 Y247C probably damaging Het
Tsc2 A G 17: 24,607,755 W896R probably damaging Het
Vmn1r157 T C 7: 22,761,700 S2P probably benign Het
Xkr4 T A 1: 3,216,810 T386S probably damaging Het
Zdhhc24 T G 19: 4,878,861 V38G possibly damaging Het
Other mutations in Nelfcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Nelfcd APN 2 174423515 splice site probably benign
IGL02175:Nelfcd APN 2 174420382 missense probably benign 0.01
IGL02955:Nelfcd APN 2 174422598 missense probably damaging 0.98
IGL03193:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03194:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03203:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03217:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03237:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03273:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03278:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03289:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03365:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03398:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03405:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03407:Nelfcd APN 2 174426832 missense possibly damaging 0.87
R0593:Nelfcd UTSW 2 174423430 missense probably benign 0.00
R0751:Nelfcd UTSW 2 174423014 missense probably benign 0.03
R1852:Nelfcd UTSW 2 174423978 splice site probably null
R2040:Nelfcd UTSW 2 174420082 missense probably damaging 1.00
R3606:Nelfcd UTSW 2 174426544 missense probably benign 0.10
R3716:Nelfcd UTSW 2 174423005 missense possibly damaging 0.51
R4235:Nelfcd UTSW 2 174427048 missense probably damaging 1.00
R4607:Nelfcd UTSW 2 174423162 missense probably benign 0.01
R4775:Nelfcd UTSW 2 174426576 missense probably damaging 0.96
R5104:Nelfcd UTSW 2 174426366 missense probably benign 0.10
R5859:Nelfcd UTSW 2 174427063 makesense probably null
R6025:Nelfcd UTSW 2 174426818 missense probably damaging 1.00
R6104:Nelfcd UTSW 2 174423457 missense probably damaging 0.99
R6280:Nelfcd UTSW 2 174415946 missense probably benign
R7382:Nelfcd UTSW 2 174423383 missense probably benign 0.00
R7532:Nelfcd UTSW 2 174426396 missense probably damaging 1.00
R7545:Nelfcd UTSW 2 174423978 splice site probably null
R7766:Nelfcd UTSW 2 174426832 missense possibly damaging 0.87
Z1088:Nelfcd UTSW 2 174426494 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAGTTGACTGGCTCACTGC -3'
(R):5'- CCATCTTCTAGAAAGTTACAGGGAG -3'

Sequencing Primer
(F):5'- TGACTGGCTCACTGCTCTGAAAG -3'
(R):5'- GACAAGGTCAGGTCACAGTG -3'
Posted On2019-06-26