Incidental Mutation 'R7249:Ap3d1'
ID563768
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R7249 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80741933 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably damaging
Transcript: ENSMUST00000020420
AA Change: D20G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,341 T38A probably benign Het
3425401B19Rik G T 14: 32,663,314 S231R possibly damaging Het
Abi1 T C 2: 22,957,089 E250G possibly damaging Het
Actl6b T A 5: 137,555,085 S120T probably damaging Het
Adgrv1 G A 13: 81,374,259 H5920Y probably damaging Het
Adra2c G A 5: 35,280,955 R357H probably damaging Het
Arfgef3 A T 10: 18,630,835 D847E possibly damaging Het
Cacna1d T C 14: 30,142,703 E434G probably damaging Het
Carm1 T C 9: 21,586,209 Y356H probably benign Het
Clip1 T C 5: 123,603,600 K1075R probably damaging Het
Cyp27b1 G T 10: 127,051,049 probably null Het
D630045J12Rik A T 6: 38,136,950 V1769D possibly damaging Het
Dchs2 C T 3: 83,128,029 Q28* probably null Het
Dpp4 A G 2: 62,385,203 F107L probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Faap24 A G 7: 35,395,060 V105A probably benign Het
Gabra6 A T 11: 42,317,432 D166E probably damaging Het
Gfpt1 A G 6: 87,056,144 E117G probably damaging Het
H2-T10 T C 17: 36,119,377 D224G probably damaging Het
Hspa12a T A 19: 58,805,433 E332V probably benign Het
Htr5b T A 1: 121,510,474 N343Y probably damaging Het
Irf8 C A 8: 120,739,832 N5K possibly damaging Het
Itgb1 C A 8: 128,720,404 Q467K probably benign Het
Itpr2 C A 6: 146,311,052 C1522F probably damaging Het
Jmjd1c T A 10: 67,189,817 L138I probably benign Het
Lrrc8b G T 5: 105,481,267 R493L probably benign Het
Malrd1 G T 2: 15,623,340 C400F probably damaging Het
March8 G A 6: 116,406,234 E257K probably benign Het
Mastl G A 2: 23,146,139 H122Y probably damaging Het
Mis18a T C 16: 90,726,314 K98R possibly damaging Het
Msra A G 14: 64,440,763 V28A probably benign Het
Mtmr7 A G 8: 40,590,477 V177A probably benign Het
Nelfcd T C 2: 174,423,206 probably null Het
Nemp1 T C 10: 127,693,526 S226P probably damaging Het
Nmnat1 G A 4: 149,469,642 T147I probably null Het
Ntng2 A G 2: 29,227,992 V148A probably benign Het
Nup214 A G 2: 31,988,233 H304R possibly damaging Het
Olfr1239 T C 2: 89,417,873 Y180C probably damaging Het
Phldb2 C A 16: 45,801,614 A623S probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkn3 G A 2: 30,084,761 R429Q probably benign Het
Plcb4 A G 2: 136,007,821 probably null Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnp G A 14: 50,951,430 V227I probably benign Het
Pskh1 T C 8: 105,913,254 S189P possibly damaging Het
Rbpms2 T G 9: 65,649,350 V24G probably damaging Het
Robo3 T A 9: 37,424,833 I446L probably benign Het
Sept8 A T 11: 53,535,122 K174I probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slco4a1 A G 2: 180,464,811 Y262C probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spidr T C 16: 15,966,648 S519G probably benign Het
Ssx2ip A G 3: 146,426,438 N218S possibly damaging Het
Svil T C 18: 5,056,270 V381A probably benign Het
Svil T C 18: 5,062,247 S769P probably damaging Het
Tep1 A T 14: 50,824,275 C2595S possibly damaging Het
Tiam1 T C 16: 89,843,255 Y858C probably damaging Het
Tie1 A G 4: 118,486,228 V146A probably benign Het
Traf3ip1 G T 1: 91,527,639 E578D probably damaging Het
Trim23 A G 13: 104,188,155 Y247C probably damaging Het
Tsc2 A G 17: 24,607,755 W896R probably damaging Het
Vmn1r157 T C 7: 22,761,700 S2P probably benign Het
Xkr4 T A 1: 3,216,810 T386S probably damaging Het
Zdhhc24 T G 19: 4,878,861 V38G possibly damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTTGGACAGCGCCTGTTTC -3'
(R):5'- ATCTTGGCCGCCATTTGCAG -3'

Sequencing Primer
(F):5'- ACAGCGCCTGTTTCAAGCTG -3'
(R):5'- ATTTGCAGCGGCCCTAAG -3'
Posted On2019-06-26