Incidental Mutation 'R7249:H2-T10'
ID563787
Institutional Source Beutler Lab
Gene Symbol H2-T10
Ensembl Gene ENSMUSG00000079491
Gene Namehistocompatibility 2, T region locus 10
SynonymsH-2T10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7249 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36115876-36121465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36119377 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 224 (D224G)
Ref Sequence ENSEMBL: ENSMUSP00000127602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046131] [ENSMUST00000166442] [ENSMUST00000173128] [ENSMUST00000174382]
Predicted Effect probably benign
Transcript: ENSMUST00000046131
SMART Domains Protein: ENSMUSP00000040558
Gene: ENSMUSG00000092243

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166442
AA Change: D224G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127602
Gene: ENSMUSG00000079491
AA Change: D224G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 6.2e-49 PFAM
IGc1 210 281 4.18e-24 SMART
transmembrane domain 294 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173128
SMART Domains Protein: ENSMUSP00000134339
Gene: ENSMUSG00000092277

DomainStartEndE-ValueType
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174382
SMART Domains Protein: ENSMUSP00000133893
Gene: ENSMUSG00000079491

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 205 9.5e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,341 T38A probably benign Het
3425401B19Rik G T 14: 32,663,314 S231R possibly damaging Het
Abi1 T C 2: 22,957,089 E250G possibly damaging Het
Actl6b T A 5: 137,555,085 S120T probably damaging Het
Adgrv1 G A 13: 81,374,259 H5920Y probably damaging Het
Adra2c G A 5: 35,280,955 R357H probably damaging Het
Ap3d1 T C 10: 80,741,933 D20G probably damaging Het
Arfgef3 A T 10: 18,630,835 D847E possibly damaging Het
Cacna1d T C 14: 30,142,703 E434G probably damaging Het
Carm1 T C 9: 21,586,209 Y356H probably benign Het
Clip1 T C 5: 123,603,600 K1075R probably damaging Het
Cyp27b1 G T 10: 127,051,049 probably null Het
D630045J12Rik A T 6: 38,136,950 V1769D possibly damaging Het
Dchs2 C T 3: 83,128,029 Q28* probably null Het
Dpp4 A G 2: 62,385,203 F107L probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Faap24 A G 7: 35,395,060 V105A probably benign Het
Gabra6 A T 11: 42,317,432 D166E probably damaging Het
Gfpt1 A G 6: 87,056,144 E117G probably damaging Het
Hspa12a T A 19: 58,805,433 E332V probably benign Het
Htr5b T A 1: 121,510,474 N343Y probably damaging Het
Irf8 C A 8: 120,739,832 N5K possibly damaging Het
Itgb1 C A 8: 128,720,404 Q467K probably benign Het
Itpr2 C A 6: 146,311,052 C1522F probably damaging Het
Jmjd1c T A 10: 67,189,817 L138I probably benign Het
Lrrc8b G T 5: 105,481,267 R493L probably benign Het
Malrd1 G T 2: 15,623,340 C400F probably damaging Het
March8 G A 6: 116,406,234 E257K probably benign Het
Mastl G A 2: 23,146,139 H122Y probably damaging Het
Mis18a T C 16: 90,726,314 K98R possibly damaging Het
Msra A G 14: 64,440,763 V28A probably benign Het
Mtmr7 A G 8: 40,590,477 V177A probably benign Het
Nelfcd T C 2: 174,423,206 probably null Het
Nemp1 T C 10: 127,693,526 S226P probably damaging Het
Nmnat1 G A 4: 149,469,642 T147I probably null Het
Ntng2 A G 2: 29,227,992 V148A probably benign Het
Nup214 A G 2: 31,988,233 H304R possibly damaging Het
Olfr1239 T C 2: 89,417,873 Y180C probably damaging Het
Phldb2 C A 16: 45,801,614 A623S probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkn3 G A 2: 30,084,761 R429Q probably benign Het
Plcb4 A G 2: 136,007,821 probably null Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnp G A 14: 50,951,430 V227I probably benign Het
Pskh1 T C 8: 105,913,254 S189P possibly damaging Het
Rbpms2 T G 9: 65,649,350 V24G probably damaging Het
Robo3 T A 9: 37,424,833 I446L probably benign Het
Sept8 A T 11: 53,535,122 K174I probably damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Slco4a1 A G 2: 180,464,811 Y262C probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spidr T C 16: 15,966,648 S519G probably benign Het
Ssx2ip A G 3: 146,426,438 N218S possibly damaging Het
Svil T C 18: 5,056,270 V381A probably benign Het
Svil T C 18: 5,062,247 S769P probably damaging Het
Tep1 A T 14: 50,824,275 C2595S possibly damaging Het
Tiam1 T C 16: 89,843,255 Y858C probably damaging Het
Tie1 A G 4: 118,486,228 V146A probably benign Het
Traf3ip1 G T 1: 91,527,639 E578D probably damaging Het
Trim23 A G 13: 104,188,155 Y247C probably damaging Het
Tsc2 A G 17: 24,607,755 W896R probably damaging Het
Vmn1r157 T C 7: 22,761,700 S2P probably benign Het
Xkr4 T A 1: 3,216,810 T386S probably damaging Het
Zdhhc24 T G 19: 4,878,861 V38G possibly damaging Het
Other mutations in H2-T10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:H2-T10 APN 17 36120710 missense probably benign 0.08
IGL01946:H2-T10 APN 17 36120716 missense possibly damaging 0.45
IGL03367:H2-T10 APN 17 36120393 missense possibly damaging 0.81
IGL03381:H2-T10 APN 17 36119354 missense probably benign
IGL03381:H2-T10 APN 17 36119357 nonsense probably null
FR4304:H2-T10 UTSW 17 36120281 frame shift probably null
R0305:H2-T10 UTSW 17 36119368 missense probably damaging 1.00
R1446:H2-T10 UTSW 17 36119374 missense possibly damaging 0.87
R1483:H2-T10 UTSW 17 36121146 missense probably benign 0.44
R2038:H2-T10 UTSW 17 36119425 missense probably benign 0.00
R2402:H2-T10 UTSW 17 36117739 splice site probably null
R4755:H2-T10 UTSW 17 36118945 nonsense probably null
R4957:H2-T10 UTSW 17 36117416 utr 3 prime probably benign
R5162:H2-T10 UTSW 17 36118951 unclassified probably null
R5568:H2-T10 UTSW 17 36119187 critical splice donor site probably null
R6226:H2-T10 UTSW 17 36121083 missense probably damaging 0.99
R6850:H2-T10 UTSW 17 36119260 missense probably damaging 1.00
R7324:H2-T10 UTSW 17 36119297 missense probably damaging 1.00
R7466:H2-T10 UTSW 17 36120849 missense probably benign 0.10
R7679:H2-T10 UTSW 17 36119324 missense not run
R7767:H2-T10 UTSW 17 36117730 missense probably benign 0.02
R7901:H2-T10 UTSW 17 36120251 missense probably benign
R7984:H2-T10 UTSW 17 36120251 missense probably benign
RF032:H2-T10 UTSW 17 36120294 frame shift probably null
RF046:H2-T10 UTSW 17 36120294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTTTGGTACCATGCAGGCTC -3'
(R):5'- AGATGATGGACACCCTAATCCC -3'

Sequencing Primer
(F):5'- TACCATGCAGGCTCTGGGAAG -3'
(R):5'- TAATCCCACCGCAGTCCTC -3'
Posted On2019-06-26