Incidental Mutation 'R0580:Ext2'
ID56379
Institutional Source Beutler Lab
Gene Symbol Ext2
Ensembl Gene ENSMUSG00000027198
Gene Nameexostoses (multiple) 2
Synonyms
MMRRC Submission 038770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0580 (G1)
Quality Score136
Status Validated
Chromosome2
Chromosomal Location93661028-93822568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93795725 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 330 (V330E)
Ref Sequence ENSEMBL: ENSMUSP00000138956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000125407] [ENSMUST00000184931]
Predicted Effect probably benign
Transcript: ENSMUST00000028623
AA Change: V330E

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: V330E

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 2.4e-59 PFAM
Pfam:Glyco_transf_64 456 701 1.1e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123649
Predicted Effect probably benign
Transcript: ENSMUST00000125407
AA Change: V330E

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198
AA Change: V330E

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 8.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152344
Predicted Effect probably benign
Transcript: ENSMUST00000184931
AA Change: V330E

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198
AA Change: V330E

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Meta Mutation Damage Score 0.6569 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,305,956 probably null Het
Adgrg5 T C 8: 94,937,344 probably null Het
Akap12 A T 10: 4,354,741 D517V possibly damaging Het
Arhgap23 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 97,446,536 probably null Het
Bpi A T 2: 158,258,295 M1L probably damaging Het
Carm1 C T 9: 21,583,584 P339S probably damaging Het
Chchd3 A C 6: 32,893,390 probably null Het
Chd9 T C 8: 90,994,563 V520A possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Col10a1 A G 10: 34,394,952 R307G probably benign Het
Cpeb3 T C 19: 37,174,035 T314A probably benign Het
Csmd1 A T 8: 15,910,528 Y3296N probably damaging Het
Dtx2 A T 5: 136,032,326 T521S probably damaging Het
Extl3 A G 14: 65,075,729 L668P probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gm8298 T A 3: 59,877,049 D314E probably damaging Het
Grm8 A G 6: 27,761,371 probably benign Het
Herc2 T A 7: 56,138,791 V1763D probably damaging Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqce A G 5: 140,665,401 F768L possibly damaging Het
Kntc1 G A 5: 123,803,669 V1809I probably benign Het
Lyzl1 A C 18: 4,181,134 T58P probably damaging Het
Mlxipl A G 5: 135,123,975 T287A probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Net1 A G 13: 3,886,612 Y264H probably damaging Het
Nnmt T C 9: 48,592,300 D142G probably damaging Het
Nod2 T A 8: 88,664,406 I432N probably damaging Het
Olfr1393 T A 11: 49,280,622 I158N probably damaging Het
Olfr711 A G 7: 106,972,240 Y35H probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pign A C 1: 105,591,694 I501S probably benign Het
Scgb2b19 A T 7: 33,278,570 S101T probably benign Het
Slc7a5 A T 8: 121,885,116 M391K probably benign Het
Sptan1 A G 2: 30,007,575 R1217G probably damaging Het
Srgap2 A G 1: 131,349,501 V336A possibly damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Syt10 A T 15: 89,827,176 D51E probably benign Het
Vmn2r96 T C 17: 18,582,638 V270A probably damaging Het
Other mutations in Ext2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Ext2 APN 2 93791073 missense probably benign
IGL01554:Ext2 APN 2 93811949 missense probably damaging 1.00
IGL01768:Ext2 APN 2 93791110 splice site probably benign
IGL02160:Ext2 APN 2 93813584 missense probably benign
IGL02677:Ext2 APN 2 93707245 missense probably damaging 1.00
IGL02939:Ext2 APN 2 93704619 splice site probably null
IGL03013:Ext2 APN 2 93707226 intron probably benign
IGL03286:Ext2 APN 2 93707272 missense probably damaging 1.00
R0018:Ext2 UTSW 2 93795692 missense probably damaging 1.00
R0526:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R1383:Ext2 UTSW 2 93806113 missense possibly damaging 0.92
R1538:Ext2 UTSW 2 93707287 missense probably damaging 1.00
R1743:Ext2 UTSW 2 93730225 missense probably damaging 1.00
R1792:Ext2 UTSW 2 93704545 missense probably damaging 1.00
R2874:Ext2 UTSW 2 93739686 missense possibly damaging 0.95
R3122:Ext2 UTSW 2 93813825 missense probably damaging 1.00
R4624:Ext2 UTSW 2 93703200 missense probably benign 0.26
R4653:Ext2 UTSW 2 93696159 missense probably benign 0.22
R4826:Ext2 UTSW 2 93762630 missense probably benign 0.15
R4828:Ext2 UTSW 2 93795767 missense probably benign 0.08
R4936:Ext2 UTSW 2 93813679 nonsense probably null
R5311:Ext2 UTSW 2 93696261 missense probably benign 0.04
R5799:Ext2 UTSW 2 93811972 missense probably benign 0.01
R5850:Ext2 UTSW 2 93813659 missense possibly damaging 0.94
R6230:Ext2 UTSW 2 93762620 missense probably damaging 1.00
R6488:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R7047:Ext2 UTSW 2 93739657 missense probably damaging 0.99
R7173:Ext2 UTSW 2 93813612 missense probably damaging 1.00
R7391:Ext2 UTSW 2 93730267 missense probably damaging 1.00
R7530:Ext2 UTSW 2 93661653 missense probably benign 0.00
R7545:Ext2 UTSW 2 93813763 missense probably benign
Z1177:Ext2 UTSW 2 93703275 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGTGACATTCTTGACAGTGCTC -3'
(R):5'- TGAACATGTGCAGAACACTAGTCCC -3'

Sequencing Primer
(F):5'- TCAACCTGAAGTtagttctcaaacc -3'
(R):5'- CCTTCGTCACAGATGTGAGGTC -3'
Posted On2013-07-11