Mutagenetix > Incidental Mutations

Incidental Mutation 'R7250:Gstm1'

563808

Institutional Source

Beutler Lab

Gene Symbol

Gstm1

Ensembl Gene

ENSMUSG00000058135

Gene Name

glutathione S-transferase, mu 1

Synonyms

Gstb-1, Gstb1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R7250 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108012255-108017973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108016393 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 99 (I99F)

Ref Sequence

ENSEMBL: ENSMUSP00000004140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]

Predicted Effect

probably damaging
Transcript: ENSMUST00000004140
AA Change: I99F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135
AA Change: I99F

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	1.3e-20	PFAM
Pfam:GST_C_3	40	190	5.2e-11	PFAM
Pfam:GST_C	104	192	3.7e-18	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135
AA Change: I99F

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	8.3e-24	PFAM
Pfam:GST_C	104	201	6.7e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153314
AA Change: I40F

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135
AA Change: I40F

Domain	Start	End	E-Value	Type
Pfam:GST_N	1	23	1.7e-7	PFAM
Pfam:GST_C	45	168	1.2e-18	PFAM
Pfam:GST_C_3	92	166	8.3e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	G	T	X: 78,370,705	M345I	probably benign	Het
Actl7b	T	A	4: 56,741,035	M108L	probably benign	Het
Adgrf3	T	A	5: 30,195,682	I934L	probably damaging	Het
Adprm	A	G	11: 67,041,624	V153A	probably benign	Het
Aif1l	G	A	2: 31,969,752	V109M	probably damaging	Het
Asphd1	T	A	7: 126,946,770	E307V	probably damaging	Het
Ate1	T	A	7: 130,519,971		probably benign	Het
BC048403	T	C	10: 121,745,471	S126P	possibly damaging	Het
BC067074	T	G	13: 113,318,815	I465R		Het
Borcs7	A	G	19: 46,699,608	H64R	probably damaging	Het
C1qtnf1	A	G	11: 118,448,350	*282W	probably null	Het
Cacna1c	A	G	6: 118,598,005	C1985R		Het
Cacna1c	A	T	6: 118,696,451	V647E		Het
Cacna1d	A	G	14: 30,075,151	S1497P	probably damaging	Het
Cacna1e	T	A	1: 154,700,489	I133F	possibly damaging	Het
Ccdc63	A	T	5: 122,122,843	L206H	probably damaging	Het
Ccdc84	A	G	9: 44,412,451		probably null	Het
D430041D05Rik	T	C	2: 104,256,616	T672A	possibly damaging	Het
D630045J12Rik	G	T	6: 38,142,611	T1732K	possibly damaging	Het
D930020B18Rik	T	C	10: 121,671,831	I158T	probably damaging	Het
Ddx52	G	A	11: 83,944,566	G106D	probably benign	Het
Dock2	A	G	11: 34,695,205	V550A	probably benign	Het
Dock2	C	T	11: 34,695,293	D521N	probably damaging	Het
F13b	T	C	1: 139,516,489		probably null	Het
Fchsd2	A	G	7: 101,259,685	K431R	possibly damaging	Het
Fez1	C	T	9: 36,867,794	R256C	probably damaging	Het
Gjd4	T	A	18: 9,280,391	Q229L	probably benign	Het
Gpr45	T	A	1: 43,032,371	I58N	probably damaging	Het
Gtpbp8	T	A	16: 44,743,862	T149S	probably damaging	Het
H2-Ab1	A	G	17: 34,267,507	D180G	probably damaging	Het
Hdhd5	A	G	6: 120,517,055	I188T	possibly damaging	Het
Hfm1	T	C	5: 106,904,331	I300V	probably benign	Het
Hnrnpr	T	G	4: 136,332,435	D283E	probably benign	Het
Hsp90b1	T	C	10: 86,691,708	E768G	unknown	Het
Kcna4	C	A	2: 107,296,318	Q466K	possibly damaging	Het
Kcnk6	A	G	7: 29,232,194	L97P	probably benign	Het
Kdelc2	C	T	9: 53,390,521	Q158*	probably null	Het
Klf5	A	G	14: 99,299,019	S9G	probably benign	Het
Kmt2c	C	A	5: 25,299,491	K3606N	probably damaging	Het
Kmt2c	T	C	5: 25,309,807	T3013A	probably benign	Het
Lancl1	A	G	1: 67,009,299	Y207H	possibly damaging	Het
Lipe	G	C	7: 25,388,660		probably benign	Het
Lrrc66	T	A	5: 73,610,881	H239L	probably benign	Het
Ltbp2	C	T	12: 84,787,392	W1441*	probably null	Het
Man2a1	T	C	17: 64,636,588	S213P	probably benign	Het
Mapre2	C	T	18: 23,858,062	A171V	possibly damaging	Het
Mdn1	T	A	4: 32,695,427	D1155E	probably damaging	Het
Mki67	T	C	7: 135,699,324	D1327G	possibly damaging	Het
Mx2	T	C	16: 97,547,464	I279T	probably damaging	Het
Myo5c	A	G	9: 75,262,215	T441A	probably damaging	Het
Nlrp9a	T	G	7: 26,558,718	V587G	possibly damaging	Het
Npas2	A	T	1: 39,338,107	T517S	probably damaging	Het
Npy1r	T	C	8: 66,705,060	S341P	probably benign	Het
Ntm	A	G	9: 29,411,692	W11R	probably benign	Het
Nxpe2	A	T	9: 48,326,796	I53N	possibly damaging	Het
Olfr456	A	G	6: 42,486,755	V146A	probably benign	Het
Olfr655	A	T	7: 104,596,531	Y217N	probably damaging	Het
Olfr981	T	A	9: 40,022,754	Y120*	probably null	Het
Onecut2	T	C	18: 64,386,440	F443L	probably benign	Het
Parp2	T	A	14: 50,817,344	V248E	probably benign	Het
Pcdh12	C	A	18: 38,281,976	V699L	probably benign	Het
Pja2	G	A	17: 64,309,456	P148L	probably benign	Het
Ppip5k2	T	G	1: 97,745,462	D415A	probably benign	Het
Prss47	A	G	13: 65,052,541	S74P	probably benign	Het
Ptprg	G	T	14: 12,166,767	M723I	probably benign	Het
Qsox2	A	T	2: 26,228,432	I109N	probably damaging	Het
Ranbp3l	A	G	15: 9,011,980	E217G	probably benign	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rgs12	T	A	5: 34,965,497	F208Y	probably damaging	Het
Rin3	C	T	12: 102,368,634	T268I	unknown	Het
Rttn	T	A	18: 88,989,523	D427E	probably benign	Het
Samd13	G	A	3: 146,646,324	P91S	probably benign	Het
Samd9l	T	C	6: 3,374,201	D1020G	possibly damaging	Het
Sec62	T	G	3: 30,812,347	L201V	possibly damaging	Het
Setdb1	C	T	3: 95,354,541		probably null	Het
Sf3a3	A	T	4: 124,722,915	T197S	probably benign	Het
Slc20a1	A	T	2: 129,209,924	I618F	possibly damaging	Het
Slc38a3	A	T	9: 107,656,666	M186K	probably benign	Het
Slc39a13	T	C	2: 91,063,158	T319A	probably benign	Het
Slc44a4	T	C	17: 34,918,544		probably null	Het
St3gal1	A	C	15: 67,106,729	D314E	possibly damaging	Het
Suclg1	A	G	6: 73,271,091	N265S	probably benign	Het
Sult2b1	A	T	7: 45,783,937	V2D	unknown	Het
Supv3l1	T	A	10: 62,445,067	I182F	probably damaging	Het
Tcp11l2	T	C	10: 84,587,241		probably null	Het
Tenm2	C	A	11: 36,072,798	L935F	probably damaging	Het
Tnks	T	A	8: 34,851,758	I790F	probably damaging	Het
Top2b	C	T	14: 16,420,411	T1274I	probably benign	Het
Tpi1	A	T	6: 124,812,478	I178N	probably damaging	Het
Trav9d-1	A	T	14: 52,792,696	S86C	probably damaging	Het
Treml2	A	G	17: 48,309,127	E265G	probably benign	Het
Trpm7	A	T	2: 126,826,765	S744T	possibly damaging	Het
Usp33	T	A	3: 152,392,362	L909*	probably null	Het
Vcan	A	G	13: 89,721,686	I210T	probably damaging	Het
Vcan	A	T	13: 89,731,457		probably null	Het
Vsig10l	A	T	7: 43,463,675	D17V	probably benign	Het
Zbtb7b	T	A	3: 89,379,669	T498S	probably benign	Het
Zfp366	T	A	13: 99,229,568	H412Q	probably damaging	Het
Zfp53	C	A	17: 21,509,578	D624E	probably damaging	Het
Zfp827	A	T	8: 79,190,092	D432V		Het
Zic1	T	C	9: 91,364,975	T15A	probably damaging	Het
Zswim8	T	C	14: 20,719,968	C1368R	probably damaging	Het

Other mutations in Gstm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0335:Gstm1	UTSW	3	108012696	missense	possibly damaging	0.87
R0458:Gstm1	UTSW	3	108017363	missense	probably benign	0.01
R0907:Gstm1	UTSW	3	108017380	missense	probably damaging	1.00
R1069:Gstm1	UTSW	3	108012748	missense	probably damaging	1.00
R1180:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R1181:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R1998:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R2000:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R4483:Gstm1	UTSW	3	108016518	critical splice donor site	probably null
R4857:Gstm1	UTSW	3	108016408	missense	possibly damaging	0.67
R5192:Gstm1	UTSW	3	108014943	critical splice donor site	probably null
R5262:Gstm1	UTSW	3	108016363	missense	probably benign	0.01
R5356:Gstm1	UTSW	3	108012736	missense	probably benign	0.00
R5485:Gstm1	UTSW	3	108017404	missense	probably damaging	1.00
R6323:Gstm1	UTSW	3	108017747	missense	probably benign	0.44
R7165:Gstm1	UTSW	3	108016377	missense	probably benign
X0023:Gstm1	UTSW	3	108012727	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTCATCCTGCTGGTAAGATC -3'
(R):5'- CAGCTGCCTTACTTGATCGATG -3'

Sequencing Primer
(F):5'- TCATCCTGCTGGTAAGATCAGAAAGC -3'
(R):5'- GATCGATGGATCACACAAGATCAC -3'

Posted On

2019-06-26