Incidental Mutation 'R7250:Lipe'
ID563830
Institutional Source Beutler Lab
Gene Symbol Lipe
Ensembl Gene ENSMUSG00000003123
Gene Namelipase, hormone sensitive
Synonyms4933403G17Rik, HSL
MMRRC Submission
Accession Numbers

Genbank: NM_010719, NM_001039507; MGI: 96790

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7250 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25379527-25398710 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to C at 25388660 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003207] [ENSMUST00000054301] [ENSMUST00000149349] [ENSMUST00000205698] [ENSMUST00000205923] [ENSMUST00000206861]
Predicted Effect probably benign
Transcript: ENSMUST00000003207
SMART Domains Protein: ENSMUSP00000003207
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
Pfam:HSL_N 44 358 4.6e-148 PFAM
Pfam:DUF2424 345 504 1.1e-8 PFAM
Pfam:Abhydrolase_3 388 548 3e-36 PFAM
low complexity region 611 626 N/A INTRINSIC
Pfam:Abhydrolase_3 684 771 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054301
SMART Domains Protein: ENSMUSP00000050935
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
Pfam:HSL_N 1 315 1.4e-148 PFAM
Pfam:DUF2424 302 461 1.5e-8 PFAM
Pfam:Abhydrolase_3 345 505 5.2e-36 PFAM
low complexity region 568 583 N/A INTRINSIC
Pfam:Abhydrolase_3 641 728 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149349
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205698
Predicted Effect probably benign
Transcript: ENSMUST00000205923
Predicted Effect probably benign
Transcript: ENSMUST00000206861
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations of this locus result in abnormal lipid homeostasis and, in some lines, defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(5) Gene trapped(2)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Actl7b T A 4: 56,741,035 M108L probably benign Het
Adgrf3 T A 5: 30,195,682 I934L probably damaging Het
Adprm A G 11: 67,041,624 V153A probably benign Het
Aif1l G A 2: 31,969,752 V109M probably damaging Het
Asphd1 T A 7: 126,946,770 E307V probably damaging Het
Ate1 T A 7: 130,519,971 probably benign Het
BC048403 T C 10: 121,745,471 S126P possibly damaging Het
BC067074 T G 13: 113,318,815 I465R Het
Borcs7 A G 19: 46,699,608 H64R probably damaging Het
C1qtnf1 A G 11: 118,448,350 *282W probably null Het
Cacna1c A G 6: 118,598,005 C1985R Het
Cacna1c A T 6: 118,696,451 V647E Het
Cacna1d A G 14: 30,075,151 S1497P probably damaging Het
Cacna1e T A 1: 154,700,489 I133F possibly damaging Het
Ccdc63 A T 5: 122,122,843 L206H probably damaging Het
Ccdc84 A G 9: 44,412,451 probably null Het
D430041D05Rik T C 2: 104,256,616 T672A possibly damaging Het
D630045J12Rik G T 6: 38,142,611 T1732K possibly damaging Het
D930020B18Rik T C 10: 121,671,831 I158T probably damaging Het
Ddx52 G A 11: 83,944,566 G106D probably benign Het
Dock2 A G 11: 34,695,205 V550A probably benign Het
Dock2 C T 11: 34,695,293 D521N probably damaging Het
F13b T C 1: 139,516,489 probably null Het
Fchsd2 A G 7: 101,259,685 K431R possibly damaging Het
Fez1 C T 9: 36,867,794 R256C probably damaging Het
Gjd4 T A 18: 9,280,391 Q229L probably benign Het
Gpr45 T A 1: 43,032,371 I58N probably damaging Het
Gstm1 T A 3: 108,016,393 I99F probably damaging Het
Gtpbp8 T A 16: 44,743,862 T149S probably damaging Het
H2-Ab1 A G 17: 34,267,507 D180G probably damaging Het
Hdhd5 A G 6: 120,517,055 I188T possibly damaging Het
Hfm1 T C 5: 106,904,331 I300V probably benign Het
Hnrnpr T G 4: 136,332,435 D283E probably benign Het
Hsp90b1 T C 10: 86,691,708 E768G unknown Het
Kcna4 C A 2: 107,296,318 Q466K possibly damaging Het
Kcnk6 A G 7: 29,232,194 L97P probably benign Het
Kdelc2 C T 9: 53,390,521 Q158* probably null Het
Klf5 A G 14: 99,299,019 S9G probably benign Het
Kmt2c C A 5: 25,299,491 K3606N probably damaging Het
Kmt2c T C 5: 25,309,807 T3013A probably benign Het
Lancl1 A G 1: 67,009,299 Y207H possibly damaging Het
Lrrc66 T A 5: 73,610,881 H239L probably benign Het
Ltbp2 C T 12: 84,787,392 W1441* probably null Het
Man2a1 T C 17: 64,636,588 S213P probably benign Het
Mapre2 C T 18: 23,858,062 A171V possibly damaging Het
Mdn1 T A 4: 32,695,427 D1155E probably damaging Het
Mki67 T C 7: 135,699,324 D1327G possibly damaging Het
Mx2 T C 16: 97,547,464 I279T probably damaging Het
Myo5c A G 9: 75,262,215 T441A probably damaging Het
Nlrp9a T G 7: 26,558,718 V587G possibly damaging Het
Npas2 A T 1: 39,338,107 T517S probably damaging Het
Npy1r T C 8: 66,705,060 S341P probably benign Het
Ntm A G 9: 29,411,692 W11R probably benign Het
Nxpe2 A T 9: 48,326,796 I53N possibly damaging Het
Olfr456 A G 6: 42,486,755 V146A probably benign Het
Olfr655 A T 7: 104,596,531 Y217N probably damaging Het
Olfr981 T A 9: 40,022,754 Y120* probably null Het
Onecut2 T C 18: 64,386,440 F443L probably benign Het
Parp2 T A 14: 50,817,344 V248E probably benign Het
Pcdh12 C A 18: 38,281,976 V699L probably benign Het
Pja2 G A 17: 64,309,456 P148L probably benign Het
Ppip5k2 T G 1: 97,745,462 D415A probably benign Het
Prss47 A G 13: 65,052,541 S74P probably benign Het
Ptprg G T 14: 12,166,767 M723I probably benign Het
Qsox2 A T 2: 26,228,432 I109N probably damaging Het
Ranbp3l A G 15: 9,011,980 E217G probably benign Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rgs12 T A 5: 34,965,497 F208Y probably damaging Het
Rin3 C T 12: 102,368,634 T268I unknown Het
Rttn T A 18: 88,989,523 D427E probably benign Het
Samd13 G A 3: 146,646,324 P91S probably benign Het
Samd9l T C 6: 3,374,201 D1020G possibly damaging Het
Sec62 T G 3: 30,812,347 L201V possibly damaging Het
Setdb1 C T 3: 95,354,541 probably null Het
Sf3a3 A T 4: 124,722,915 T197S probably benign Het
Slc20a1 A T 2: 129,209,924 I618F possibly damaging Het
Slc38a3 A T 9: 107,656,666 M186K probably benign Het
Slc39a13 T C 2: 91,063,158 T319A probably benign Het
Slc44a4 T C 17: 34,918,544 probably null Het
St3gal1 A C 15: 67,106,729 D314E possibly damaging Het
Suclg1 A G 6: 73,271,091 N265S probably benign Het
Sult2b1 A T 7: 45,783,937 V2D unknown Het
Supv3l1 T A 10: 62,445,067 I182F probably damaging Het
Tcp11l2 T C 10: 84,587,241 probably null Het
Tenm2 C A 11: 36,072,798 L935F probably damaging Het
Tnks T A 8: 34,851,758 I790F probably damaging Het
Top2b C T 14: 16,420,411 T1274I probably benign Het
Tpi1 A T 6: 124,812,478 I178N probably damaging Het
Trav9d-1 A T 14: 52,792,696 S86C probably damaging Het
Treml2 A G 17: 48,309,127 E265G probably benign Het
Trpm7 A T 2: 126,826,765 S744T possibly damaging Het
Usp33 T A 3: 152,392,362 L909* probably null Het
Vcan A G 13: 89,721,686 I210T probably damaging Het
Vcan A T 13: 89,731,457 probably null Het
Vsig10l A T 7: 43,463,675 D17V probably benign Het
Zbtb7b T A 3: 89,379,669 T498S probably benign Het
Zfp366 T A 13: 99,229,568 H412Q probably damaging Het
Zfp53 C A 17: 21,509,578 D624E probably damaging Het
Zfp827 A T 8: 79,190,092 D432V Het
Zic1 T C 9: 91,364,975 T15A probably damaging Het
Zswim8 T C 14: 20,719,968 C1368R probably damaging Het
Other mutations in Lipe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lipe APN 7 25383552 missense probably damaging 1.00
IGL00517:Lipe APN 7 25388560 unclassified probably null
IGL00817:Lipe APN 7 25388449 missense probably damaging 1.00
IGL01459:Lipe APN 7 25383542 missense probably damaging 1.00
IGL01946:Lipe APN 7 25383276 missense possibly damaging 0.90
IGL02931:Lipe APN 7 25383335 splice site probably benign
IGL02973:Lipe APN 7 25383632 missense probably damaging 0.98
IGL03091:Lipe APN 7 25380755 missense probably damaging 1.00
reservoir UTSW 7 25380143 missense probably damaging 1.00
3-1:Lipe UTSW 7 25397820 missense probably damaging 0.97
PIT4243001:Lipe UTSW 7 25395546 missense probably benign
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0432:Lipe UTSW 7 25398488 missense probably benign 0.00
R0528:Lipe UTSW 7 25398476 missense possibly damaging 0.92
R0534:Lipe UTSW 7 25388186 missense possibly damaging 0.66
R1487:Lipe UTSW 7 25384815 missense possibly damaging 0.47
R1502:Lipe UTSW 7 25398147 missense possibly damaging 0.66
R1606:Lipe UTSW 7 25388144 missense probably damaging 1.00
R1713:Lipe UTSW 7 25385325 missense probably damaging 0.99
R2147:Lipe UTSW 7 25388521 missense probably benign 0.01
R3031:Lipe UTSW 7 25384895 missense possibly damaging 0.65
R3110:Lipe UTSW 7 25398423 missense probably benign
R3112:Lipe UTSW 7 25398423 missense probably benign
R3792:Lipe UTSW 7 25397620 missense possibly damaging 0.82
R4453:Lipe UTSW 7 25397690 missense probably damaging 0.99
R4582:Lipe UTSW 7 25397702 missense probably benign
R4816:Lipe UTSW 7 25380143 missense probably damaging 1.00
R5639:Lipe UTSW 7 25383325 missense probably benign 0.00
R5653:Lipe UTSW 7 25398408 missense probably benign 0.08
R6322:Lipe UTSW 7 25380536 missense probably damaging 1.00
R6575:Lipe UTSW 7 25383324 missense probably benign 0.03
R7065:Lipe UTSW 7 25385178 critical splice donor site probably null
R7485:Lipe UTSW 7 25380611 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCCAGGTCAAAATGGTGTGC -3'
(R):5'- AAGATAATGGAAGGCCCCTGC -3'

Sequencing Primer
(F):5'- CCAACAGTTGGCCTAGGGTTG -3'
(R):5'- CTGCGTCTCCAGGAGGATTG -3'
Posted On2019-06-26