Incidental Mutation 'R0580:Kntc1'
ID56384
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission 038770-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0580 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123803669 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1809 (V1809I)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably benign
Transcript: ENSMUST00000031366
AA Change: V1809I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: V1809I

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,305,956 probably null Het
Adgrg5 T C 8: 94,937,344 probably null Het
Akap12 A T 10: 4,354,741 D517V possibly damaging Het
Arhgap23 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 97,446,536 probably null Het
Bpi A T 2: 158,258,295 M1L probably damaging Het
Carm1 C T 9: 21,583,584 P339S probably damaging Het
Chchd3 A C 6: 32,893,390 probably null Het
Chd9 T C 8: 90,994,563 V520A possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Col10a1 A G 10: 34,394,952 R307G probably benign Het
Cpeb3 T C 19: 37,174,035 T314A probably benign Het
Csmd1 A T 8: 15,910,528 Y3296N probably damaging Het
Dtx2 A T 5: 136,032,326 T521S probably damaging Het
Ext2 A T 2: 93,795,725 V330E probably benign Het
Extl3 A G 14: 65,075,729 L668P probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gm8298 T A 3: 59,877,049 D314E probably damaging Het
Grm8 A G 6: 27,761,371 probably benign Het
Herc2 T A 7: 56,138,791 V1763D probably damaging Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqce A G 5: 140,665,401 F768L possibly damaging Het
Lyzl1 A C 18: 4,181,134 T58P probably damaging Het
Mlxipl A G 5: 135,123,975 T287A probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Net1 A G 13: 3,886,612 Y264H probably damaging Het
Nnmt T C 9: 48,592,300 D142G probably damaging Het
Nod2 T A 8: 88,664,406 I432N probably damaging Het
Olfr1393 T A 11: 49,280,622 I158N probably damaging Het
Olfr711 A G 7: 106,972,240 Y35H probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pign A C 1: 105,591,694 I501S probably benign Het
Scgb2b19 A T 7: 33,278,570 S101T probably benign Het
Slc7a5 A T 8: 121,885,116 M391K probably benign Het
Sptan1 A G 2: 30,007,575 R1217G probably damaging Het
Srgap2 A G 1: 131,349,501 V336A possibly damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Syt10 A T 15: 89,827,176 D51E probably benign Het
Vmn2r96 T C 17: 18,582,638 V270A probably damaging Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
R7381:Kntc1 UTSW 5 123810908 missense probably benign 0.12
R7485:Kntc1 UTSW 5 123786956 missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123790938 missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123816755 missense probably benign 0.05
R7687:Kntc1 UTSW 5 123759089 missense probably benign 0.01
R7798:Kntc1 UTSW 5 123786294 missense probably benign
R7798:Kntc1 UTSW 5 123819117 missense possibly damaging 0.94
R7871:Kntc1 UTSW 5 123784227 missense probably damaging 1.00
R7876:Kntc1 UTSW 5 123775787 missense probably damaging 1.00
R7954:Kntc1 UTSW 5 123784227 missense probably damaging 1.00
R7959:Kntc1 UTSW 5 123775787 missense probably damaging 1.00
R7997:Kntc1 UTSW 5 123778054 missense probably damaging 0.96
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCACATCTGGCAAAGATTATCCCG -3'
(R):5'- CTATGCAAGCTGTCTGAGGGACAC -3'

Sequencing Primer
(F):5'- TGGCAAAGATTATCCCGGTGAG -3'
(R):5'- ACAGAGAGCTGCTGTCTGG -3'
Posted On2013-07-11